NAT10 (N-Acetyltransferase 10 (GCN5-Related), NAT10)

Short Description: May have histone acetyltransferase (Potential).
More information related to gene NAT10.
Products related to NAT10 Gene:
109 Products
Type
  • 105
  • 4
Species
  • 58
  • 28
  • 20
  • 2
  • 1
Application
  • 67
  • 23
  • 21
  • 16
  • 1
Fusion tag
  • 35
  • 16
  • 11
  • 10
  • 6
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 44
  • 34
  • 12
  • 9
  • 3
Insert
  • 37
  • 34
  • 18
  • 8
  • 6
Oligo-Type
  • 3
  • 1
Resistance Gene
  • 45
  • 38
  • 18
  • 4
  • 2
Expression Type
  • 88
  • 49
  • 13
Selectable Marker
  • 25
  • 24
  • 13
  • 1
Promoter
  • 32
  • 30
  • 24
  • 13
  • 8
Format
  • 49
  • 26
  • 21
  • 13

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
N-Acetyltransferase 10 (GCN5-Related) (NAT10)
Gene ID:
98956 (Mouse (Murine), NAT10)
Synonyms:
NAT10, Nat10, nat10, CC1G_12871, MCYG_05927, PITG_19671, MGYG_06040, SPAC20G8.09c, nat10.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3829216
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
N-Acetyltransferase 10 (GCN5-Related) (NAT10)
Gene ID:
55226 (Human, NAT10)
Synonyms:
NAT10, Nat10, nat10, CC1G_12871, MCYG_05927, PITG_19671, MGYG_06040, SPAC20G8.09c, nat10.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3816132
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
N-Acetyltransferase 10 (GCN5-Related) (NAT10)
Gene ID:
515001 (Cow (Bovine), NAT10)
Synonyms:
NAT10, Nat10, nat10, CC1G_12871, MCYG_05927, PITG_19671, MGYG_06040, SPAC20G8.09c, nat10.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3859117
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
N-Acetyltransferase 10 (GCN5-Related) (NAT10)
Species:
Human
Synonyms:
NAT10, Nat10, nat10, CC1G_12871, MCYG_05927, PITG_19671, MGYG_06040, SPAC20G8.09c, nat10.L
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3888653
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
N-Acetyltransferase 10 (GCN5-Related)
Species:
Human
Synonyms:
ALP, NET43, AI429152, zgc:66119, DDBDRAFT_0190093, DDBDRAFT_0234062, DDB_0190093, DDB_0234062, RGD1306717
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3191990
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
ORF
Application:
Cloning
Gene:
N-Acetyltransferase 10 (GCN5-Related) (NAT10)
Species:
Human
Synonyms:
NAT10, Nat10, nat10, CC1G_12871, MCYG_05927, PITG_19671, MGYG_06040, SPAC20G8.09c, nat10.L
Insert length:
3078 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5760537
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
N-Acetyltransferase 10 (GCN5-Related) (NAT10)
Gene ID:
98956 (Mouse (Murine), NAT10)
Synonyms:
NAT10, Nat10, nat10, CC1G_12871, MCYG_05927, PITG_19671, MGYG_06040, SPAC20G8.09c, nat10.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3829218
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
N-Acetyltransferase 10 (GCN5-Related) (NAT10)
Gene ID:
55226 (Human, NAT10)
Synonyms:
NAT10, Nat10, nat10, CC1G_12871, MCYG_05927, PITG_19671, MGYG_06040, SPAC20G8.09c, nat10.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3816130
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
N-Acetyltransferase 10 (GCN5-Related) (NAT10)
Gene ID:
515001 (Cow (Bovine), NAT10)
Synonyms:
NAT10, Nat10, nat10, CC1G_12871, MCYG_05927, PITG_19671, MGYG_06040, SPAC20G8.09c, nat10.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3859118
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
N-Acetyltransferase 10 (GCN5-Related) (NAT10)
Gene ID:
55226 (Human, NAT10)
Synonyms:
NAT10, Nat10, nat10, CC1G_12871, MCYG_05927, PITG_19671, MGYG_06040, SPAC20G8.09c, nat10.L
Insert length:
3078 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5318694
$214.67
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
N-Acetyltransferase 10 (GCN5-Related) (NAT10)
NCBI Accession:
NM_024662,NP_078938
Species:
Human
Synonyms:
NAT10, Nat10, nat10, CC1G_12871, MCYG_05927, PITG_19671, MGYG_06040, SPAC20G8.09c, nat10.L
Insert length:
4600 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3385355
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
N-Acetyltransferase 10 (GCN5-Related) (NAT10)
Species:
Human
Synonyms:
NAT10, Nat10, nat10, CC1G_12871, MCYG_05927, PITG_19671, MGYG_06040, SPAC20G8.09c, nat10.L
Insert length:
3078 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4478497
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
N-Acetyltransferase 10 (GCN5-Related) (NAT10)
Species:
Human
Synonyms:
NAT10, Nat10, nat10, CC1G_12871, MCYG_05927, PITG_19671, MGYG_06040, SPAC20G8.09c, nat10.L
Insert length:
3078 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-N-D-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4508004
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
N-Acetyltransferase 10 (GCN5-Related) (NAT10)
Species:
Human
Synonyms:
NAT10, Nat10, nat10, CC1G_12871, MCYG_05927, PITG_19671, MGYG_06040, SPAC20G8.09c, nat10.L
Insert length:
3078 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4621968
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
N-Acetyltransferase 10 (GCN5-Related) (NAT10)
Species:
Human
Synonyms:
NAT10, Nat10, nat10, CC1G_12871, MCYG_05927, PITG_19671, MGYG_06040, SPAC20G8.09c, nat10.L
Insert length:
3078 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4770165
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
N-Acetyltransferase 10 (GCN5-Related) (NAT10)
Species:
Human
Synonyms:
NAT10, Nat10, nat10, CC1G_12871, MCYG_05927, PITG_19671, MGYG_06040, SPAC20G8.09c, nat10.L
Insert length:
3078 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4439592
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
N-Acetyltransferase 10 (GCN5-Related) (NAT10)
Species:
Human
Synonyms:
NAT10, Nat10, nat10, CC1G_12871, MCYG_05927, PITG_19671, MGYG_06040, SPAC20G8.09c, nat10.L
Insert length:
3078 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-N-D-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4569213
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
N-Acetyltransferase 10 (GCN5-Related) (NAT10)
Species:
Human
Synonyms:
NAT10, Nat10, nat10, CC1G_12871, MCYG_05927, PITG_19671, MGYG_06040, SPAC20G8.09c, nat10.L
Insert length:
3078 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4706765
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
N-Acetyltransferase 10 (GCN5-Related) (NAT10)
Species:
Human
Synonyms:
NAT10, Nat10, nat10, CC1G_12871, MCYG_05927, PITG_19671, MGYG_06040, SPAC20G8.09c, nat10.L
Insert length:
3078 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4835895
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
N-Acetyltransferase 10 (GCN5-Related) (NAT10)
Gene ID:
55226 (Human, NAT10)
Synonyms:
NAT10, Nat10, nat10, CC1G_12871, MCYG_05927, PITG_19671, MGYG_06040, SPAC20G8.09c, nat10.L
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR201
Resistance Gene:
Kanamycin

Sequencing Primer:
  • pDONR201-forward
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3407648
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to NAT10

  • N-acetyltransferase 10 (NAT10)
  • N-acetyltransferase 10 (Nat10)
  • N-acetyltransferase 10 (nat10)
  • N-acetyltransferase 10 (CC1G_12871)
  • N-acetyltransferase 10 (MCYG_05927)
  • N-acetyltransferase 10 (PITG_19671)
  • N-acetyltransferase 10 (MGYG_06040)
  • N-acetyltransferase 10 (GCN5-related) (nat10)
  • ribosome biogenesis ATPase (predicted) (SPAC20G8.09c)
  • hypothetical protein (nat10)
  • N-acetyltransferase 10 (GCN5-related) L homeolog (nat10.L)
  • AI429152
  • ALP
  • DDBDRAFT_0190093
  • DDBDRAFT_0234062
  • DDB_0190093
  • DDB_0234062
  • NET43
  • RGD1306717
  • zgc:66119

Gene-IDs for different species

GENE IDSPECIES
55226 Homo sapiens
98956 Mus musculus
393617 Danio rerio
426609 Gallus gallus
483431 Canis lupus familiaris
515001 Bos taurus
6016175 Coprinopsis cinerea okayama7130
9224347 Arthroderma otae CBS 113480
9467098 Phytophthora infestans T30-4
10026747 Arthroderma gypseum CBS 118893
466485 Pan troglodytes
717452 Macaca mulatta
779537 Xenopus (Silurana) tropicalis
2542520 Schizosaccharomyces pombe 972h-
8616722 Dictyostelium discoideum AX4
100031449 Monodelphis domestica
100059185 Equus caballus
100174807 Xenopus laevis
100340636 Oryctolagus cuniculus
100386800 Callithrix jacchus
100460914 Pongo abelii
100474201 Ailuropoda melanoleuca
100511365 Sus scrofa
100543407 Meleagris gallopavo
100566182 Anolis carolinensis
100582525 Nomascus leucogenys
311257 Rattus norvegicus

Protein level used designations for NAT10

  • N-acetyltransferase 10
  • N-acetyltransferase-like protein
  • novel putative ATPase domain containing protein
  • N-acetyltransferase 10 (GCN5-related)
  • N-acetyltransferase Nat10 (predicted)
  • N-acetyltransferase 10-like
  • n-acetyltransferase 10-like
Other products related to NAT10 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com