NAT2 (N-Acetyltransferase 2 (Arylamine N-Acetyltransferase), NAT2)

Short Description: This gene encodes an enzyme that functions to both activate and deactivate arylamine and hydrazine drugs and carcinogens. Polymorphisms in this gene are responsible for the N-acetylation polymorphism in which human populations segregate into rapid, intermediate, and slow acetylator phenotypes. Polymorphisms in this gene are also associated with higher incidences of cancer and drug toxicity. A second arylamine N-acetyltransferase gene (NAT1) is located near this gene (NAT2). [provided by RefSeq, Jul 2008].
More information related to gene NAT2.
Products related to NAT2 Gene:
128 Products
Type
  • 122
  • 6
Species
  • 59
  • 42
  • 27
Application
  • 69
  • 30
  • 25
  • 16
  • 2
Fusion tag
  • 37
  • 18
  • 14
  • 12
  • 8
Vector Backbone
  • 8
  • 8
  • 6
  • 6
  • 6
Vector
  • 44
  • 40
  • 18
  • 9
  • 8
Insert
  • 45
  • 40
  • 21
  • 8
  • 6
Oligo-Type
  • 4
  • 2
Resistance Gene
  • 58
  • 32
  • 26
  • 6
  • 2
Expression Type
  • 102
  • 56
  • 13
Selectable Marker
  • 31
  • 26
  • 13
  • 1
Promoter
  • 41
  • 31
  • 20
  • 18
  • 8
Format
  • 52
  • 40
  • 24
  • 12
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
N-Acetyltransferase 2 (Arylamine N-Acetyltransferase) (NAT2)
Species:
Human
Synonyms:
NAT2, Nat2
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5756080
$147.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
N-Acetyltransferase 2 (Arylamine N-Acetyltransferase) (NAT2)
Gene ID:
10 (Human, NAT2)
Synonyms:
NAT2, Nat2
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4034222
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
N-Acetyltransferase 2 (Arylamine N-Acetyltransferase) (NAT2)
Gene ID:
10 (Human, NAT2)
Synonyms:
NAT2, Nat2
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4034221
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
N-Acetyltransferase 2 (Arylamine N-Acetyltransferase) (NAT2)
Gene ID:
17961 (Mouse (Murine), NAT2)
Synonyms:
NAT2, Nat2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4216228
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
N-Acetyltransferase 2 (Arylamine N-Acetyltransferase) (NAT2)
NCBI Accession:
NM_000015
Species:
Human
Synonyms:
NAT2, Nat2
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4103930
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Application:
Quantitative real-time PCR
Gene:
N-Acetyltransferase 2 (Arylamine N-Acetyltransferase)
Species:
Human
Synonyms:
AAC2, NAT-2, PNAT, AV377607, Nat2a, NAT, AT-2, AT-B/AT-II, AT-II, AT2
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3189466
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Application:
Quantitative real-time PCR
Gene:
N-Acetyltransferase 2 (Arylamine N-Acetyltransferase)
Species:
Mouse (Murine)
Synonyms:
AAC2, NAT-2, PNAT, AV377607, Nat2a, NAT, AT-2, AT-B/AT-II, AT-II, AT2
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3193835
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
N-Acetyltransferase 2 (Arylamine N-Acetyltransferase) (NAT2)
Gene ID:
10 (Human, NAT2)
Synonyms:
NAT2, Nat2
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4034223
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
N-Acetyltransferase 2 (Arylamine N-Acetyltransferase) (NAT2)
Gene ID:
10 (Human, NAT2)
Synonyms:
NAT2, Nat2
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4034224
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
N-Acetyltransferase 2 (Arylamine N-Acetyltransferase) (NAT2)
Gene ID:
17961 (Mouse (Murine), NAT2)
Synonyms:
NAT2, Nat2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4216227
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
N-Acetyltransferase 2 (Arylamine N-Acetyltransferase) (NAT2)
Gene ID:
10 (Human, NAT2)
Synonyms:
NAT2, Nat2
Insert length:
873 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5314298
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
N-Acetyltransferase 2 (Arylamine N-Acetyltransferase) (NAT2)
NCBI Accession:
NM_000015,NP_000006
Species:
Human
Synonyms:
NAT2, Nat2
Insert length:
1320 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3307406
$300.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
N-Acetyltransferase 2 (Arylamine N-Acetyltransferase) (NAT2)
Species:
Human
Synonyms:
NAT2, Nat2
Insert length:
873 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4478502
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
N-Acetyltransferase 2 (Arylamine N-Acetyltransferase) (NAT2)
Species:
Human
Synonyms:
NAT2, Nat2
Insert length:
873 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4621973
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
N-Acetyltransferase 2 (Arylamine N-Acetyltransferase) (NAT2)
Species:
Human
Synonyms:
NAT2, Nat2
Insert length:
873 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4770170
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
N-Acetyltransferase 2 (Arylamine N-Acetyltransferase) (NAT2)
Species:
Human
Synonyms:
NAT2, Nat2
Insert length:
873 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4439597
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
N-Acetyltransferase 2 (Arylamine N-Acetyltransferase) (NAT2)
Species:
Human
Synonyms:
NAT2, Nat2
Insert length:
873 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4706767
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
N-Acetyltransferase 2 (Arylamine N-Acetyltransferase) (NAT2)
Species:
Human
Synonyms:
NAT2, Nat2
Insert length:
873 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4706768
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
N-Acetyltransferase 2 (Arylamine N-Acetyltransferase) (NAT2)
Species:
Human
Synonyms:
NAT2, Nat2
Insert length:
873 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4835897
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
N-Acetyltransferase 2 (Arylamine N-Acetyltransferase) (NAT2)
Species:
Human
Synonyms:
NAT2, Nat2
Insert length:
873 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4835898
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to NAT2

  • N-acetyltransferase 2 (NAT2)
  • N-acetyltransferase 2 (arylamine N-acetyltransferase) (NAT2)
  • N-acetyltransferase 2 (arylamine N-acetyltransferase) (Nat2)
  • N-acetyltransferase 2 (Nat2)
  • AAC2
  • AT-2
  • AT-B/AT-II
  • AT-II
  • AT2
  • AV377607
  • NAT
  • NAT-2
  • Nat2a
  • PNAT

Gene-IDs for different species

GENE IDSPECIES
10 Homo sapiens
100008974 Oryctolagus cuniculus
17961 Mus musculus
116632 Rattus norvegicus
704357 Macaca mulatta
101840555 Mesocricetus auratus

Protein level used designations for NAT2

  • N-acetyltransferase type 2
  • arylamide acetylase 2
  • arylamine N-acetyltransferase 2
  • PNAT
  • lambda R-1
  • polymorphic arylamine N-acetyltransferase
  • N-acetyl transferase 2
  • NAT-2
  • AT-2
  • N-Acetyltransferase-2 (arylamine N-acetyltransferase)
  • N-acetyltransferase 2 (arylamine N-acetyltransferase)
  • Arylamide acetylase 2
  • NAT2 15
  • Polymorphic arylamine N-acetyltransferase
  • acetyltransferase
  • arylamine N-acetyltransferase-2
Other products related to NAT2 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com