NAT2 (N-Acetyltransferase 2 (Arylamine N-Acetyltransferase), NAT2)

Short Description: This gene encodes an enzyme that functions to both activate and deactivate arylamine and hydrazine drugs and carcinogens. Polymorphisms in this gene are responsible for the N-acetylation polymorphism in which human populations segregate into rapid, intermediate, and slow acetylator phenotypes. Polymorphisms in this gene are also associated with higher incidences of cancer and drug toxicity. A second arylamine N-acetyltransferase gene (NAT1) is located near this gene (NAT2). [provided by RefSeq, Jul 2008].
More information related to gene NAT2.
Products related to NAT2 Gene:
128 Products
  • 122
  • 6
  • 59
  • 42
  • 27
  • 69
  • 30
  • 25
  • 16
  • 2
Fusion tag
  • 37
  • 18
  • 14
  • 12
  • 8
Vector Backbone
  • 8
  • 8
  • 6
  • 6
  • 6
  • 44
  • 40
  • 18
  • 9
  • 8
  • 45
  • 40
  • 21
  • 8
  • 6
  • 4
  • 2
Resistance Gene
  • 58
  • 32
  • 26
  • 6
  • 2
Expression Type
  • 102
  • 56
  • 13
Selectable Marker
  • 31
  • 26
  • 13
  • 1
  • 41
  • 31
  • 20
  • 18
  • 8
  • 52
  • 40
  • 24
  • 12

N-Acetyltransferase 2 (Arylamine N-Acetyltransferase) (NAT2)
Gene ID:
10 (Human, NAT2)
NAT2, Nat2
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4034222
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

N-Acetyltransferase 2 (Arylamine N-Acetyltransferase) (NAT2)
Gene ID:
10 (Human, NAT2)
NAT2, Nat2
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4034221
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
N-Acetyltransferase 2 (Arylamine N-Acetyltransferase) (NAT2)
Gene ID:
17961 (Mouse (Murine), NAT2)
NAT2, Nat2
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4216228
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

N-Acetyltransferase 2 (Arylamine N-Acetyltransferase) (NAT2)
NCBI Accession:
NAT2, Nat2
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:

Sequencing Primer:
  • M13-47
  • RV-M
Catalog No. ABIN4103930
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Quantitative real-time PCR
N-Acetyltransferase 2 (Arylamine N-Acetyltransferase)
AAC2, NAT-2, PNAT, AV377607, Nat2a, NAT, AT-2, AT-B/AT-II, AT-II, AT2
-20 °C
Catalog No. ABIN3189466
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Quantitative real-time PCR
N-Acetyltransferase 2 (Arylamine N-Acetyltransferase)
Mouse (Murine)
AAC2, NAT-2, PNAT, AV377607, Nat2a, NAT, AT-2, AT-B/AT-II, AT-II, AT2
-20 °C
Catalog No. ABIN3193835
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

N-Acetyltransferase 2 (Arylamine N-Acetyltransferase) (NAT2)
NAT2, Nat2
Insert length:
873 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5756080
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

N-Acetyltransferase 2 (Arylamine N-Acetyltransferase) (NAT2)
Gene ID:
10 (Human, NAT2)
NAT2, Nat2
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4034223
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

N-Acetyltransferase 2 (Arylamine N-Acetyltransferase) (NAT2)
Gene ID:
10 (Human, NAT2)
NAT2, Nat2
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4034224
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
N-Acetyltransferase 2 (Arylamine N-Acetyltransferase) (NAT2)
Gene ID:
17961 (Mouse (Murine), NAT2)
NAT2, Nat2
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4216227
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

N-Acetyltransferase 2 (Arylamine N-Acetyltransferase) (NAT2)
Gene ID:
10 (Human, NAT2)
NAT2, Nat2
Insert length:
873 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5314298
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Protein Expression
N-Acetyltransferase 2 (Arylamine N-Acetyltransferase) (NAT2)
NCBI Accession:
NAT2, Nat2
Insert length:
1320 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3307406
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Protein Expression
N-Acetyltransferase 2 (Arylamine N-Acetyltransferase) (NAT2)
NAT2, Nat2
Insert length:
873 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
HA tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4478502
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

N-Acetyltransferase 2 (Arylamine N-Acetyltransferase) (NAT2)
NAT2, Nat2
Insert length:
873 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4621973
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

N-Acetyltransferase 2 (Arylamine N-Acetyltransferase) (NAT2)
NAT2, Nat2
Insert length:
873 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4770170
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
N-Acetyltransferase 2 (Arylamine N-Acetyltransferase) (NAT2)
NAT2, Nat2
Insert length:
873 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
His tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4439597
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

N-Acetyltransferase 2 (Arylamine N-Acetyltransferase) (NAT2)
NAT2, Nat2
Insert length:
873 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4706767
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

N-Acetyltransferase 2 (Arylamine N-Acetyltransferase) (NAT2)
NAT2, Nat2
Insert length:
873 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4706768
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

N-Acetyltransferase 2 (Arylamine N-Acetyltransferase) (NAT2)
NAT2, Nat2
Insert length:
873 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4835897
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

N-Acetyltransferase 2 (Arylamine N-Acetyltransferase) (NAT2)
NAT2, Nat2
Insert length:
873 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4835898
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to NAT2

  • N-acetyltransferase 2 (NAT2)
  • N-acetyltransferase 2 (arylamine N-acetyltransferase) (NAT2)
  • N-acetyltransferase 2 (arylamine N-acetyltransferase) (Nat2)
  • N-acetyltransferase 2 (Nat2)
  • AAC2
  • AT-2
  • AT-B/AT-II
  • AT-II
  • AT2
  • AV377607
  • NAT
  • NAT-2
  • Nat2a
  • PNAT

Gene-IDs for different species

10 Homo sapiens
100008974 Oryctolagus cuniculus
17961 Mus musculus
116632 Rattus norvegicus
704357 Macaca mulatta
101840555 Mesocricetus auratus

Protein level used designations for NAT2

  • N-acetyltransferase type 2
  • arylamide acetylase 2
  • arylamine N-acetyltransferase 2
  • PNAT
  • lambda R-1
  • polymorphic arylamine N-acetyltransferase
  • N-acetyl transferase 2
  • NAT-2
  • AT-2
  • N-Acetyltransferase-2 (arylamine N-acetyltransferase)
  • N-acetyltransferase 2 (arylamine N-acetyltransferase)
  • Arylamide acetylase 2
  • NAT2 15
  • Polymorphic arylamine N-acetyltransferase
  • acetyltransferase
  • arylamine N-acetyltransferase-2
Other products related to NAT2 such as antibodies, ELISA kits and high-purity proteins are available on our partner website