NCF1 (Neutrophil Cytosol Factor 1, NCF1)

Short Description: The protein encoded by this gene is a 47 kDa cytosolic subunit of neutrophil NADPH oxidase. This oxidase is a multicomponent enzyme that is activated to produce superoxide anion. Mutations in this gene have been associated with chronic granulomatous disease. [provided by RefSeq, Jul 2008].
More information related to gene NCF1.
Products related to NCF1 Gene:
122 Products
Type
  • 118
  • 4
Species
  • 61
  • 29
  • 28
  • 2
  • 2
Application
  • 69
  • 29
  • 27
  • 16
  • 1
Fusion tag
  • 45
  • 17
  • 11
  • 10
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 44
  • 37
  • 12
  • 12
  • 7
Insert
  • 40
  • 38
  • 24
  • 8
  • 6
Oligo-Type
  • 3
  • 1
Resistance Gene
  • 48
  • 40
  • 24
  • 6
  • 2
Expression Type
  • 95
  • 54
  • 13
  • 2
Selectable Marker
  • 30
  • 25
  • 13
  • 1
Promoter
  • 34
  • 30
  • 27
  • 12
  • 8
Format
  • 52
  • 27
  • 22
  • 21
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Neutrophil Cytosol Factor 1 (NCF1)
Species:
Human
Synonyms:
NCF1, Ncf1
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5726919
$147.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Neutrophil Cytosol Factor 1 (NCF1)
Gene ID:
281345 (Cow (Bovine), NCF1)
Synonyms:
NCF1, Ncf1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3838826
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Neutrophil Cytosol Factor 1 (NCF1)
Gene ID:
17969 (Mouse (Murine), NCF1)
Synonyms:
NCF1, Ncf1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3809741
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Neutrophil Cytosol Factor 1 (NCF1)
Gene ID:
653361 (Human, NCF1)
Synonyms:
NCF1, Ncf1
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4044304
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Neutrophil Cytosol Factor 1 (NCF1)
Gene ID:
114553 (Rat (Rattus), NCF1)
Synonyms:
NCF1, Ncf1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3879688
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Neutrophil Cytosol Factor 1 (NCF1)
Gene ID:
100124318 (Xenopus tropicalis, NCF1)
Synonyms:
NCF1, Ncf1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS107
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T3 Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4028119
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Neutrophil Cytosol Factor 1 (NCF1)
Gene ID:
653361 (Human, NCF1)
Synonyms:
NCF1, Ncf1
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4095114
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Neutrophil Cytosol Factor 1 (NCF1)
Species:
Human
Synonyms:
NCF1, Ncf1
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3562715
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Application:
Quantitative real-time PCR
Gene:
Neutrophil Cytosol Factor 1
Species:
Human
Synonyms:
NCF1A, NOXO2, SH3PXD1A, p47phox, Ncf-1, p47
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3191743
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Neutrophil Cytosol Factor 1 (NCF1)
Gene ID:
281345 (Cow (Bovine), NCF1)
Synonyms:
NCF1, Ncf1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3838825
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Neutrophil Cytosol Factor 1 (NCF1)
Gene ID:
17969 (Mouse (Murine), NCF1)
Synonyms:
NCF1, Ncf1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3809743
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Neutrophil Cytosol Factor 1 (NCF1)
Gene ID:
653361 (Human, NCF1)
Synonyms:
NCF1, Ncf1
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4044303
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Neutrophil Cytosol Factor 1 (NCF1)
Gene ID:
114553 (Rat (Rattus), NCF1)
Synonyms:
NCF1, Ncf1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3879689
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Neutrophil Cytosol Factor 1 (NCF1)
Gene ID:
100124318 (Xenopus tropicalis, NCF1)
Synonyms:
NCF1, Ncf1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS107
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T3 Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4028118
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Neutrophil Cytosol Factor 1 (NCF1)
Gene ID:
653361 (Human, NCF1)
Synonyms:
NCF1, Ncf1
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4095113
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Neutrophil Cytosol Factor 1 (NCF1)
Gene ID:
653361 (Human, NCF1)
Synonyms:
NCF1, Ncf1
Insert length:
1173 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5316907
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Neutrophil Cytosol Factor 1 (NCF1)
Species:
Human
Synonyms:
NCF1, Ncf1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948164

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3925309
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Neutrophil Cytosol Factor 1 (NCF1)
Species:
Human
Synonyms:
NCF1, Ncf1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948163

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3925307
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Neutrophil Cytosol Factor 1 (NCF1)
Species:
Human
Synonyms:
NCF1, Ncf1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-untagged
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948161

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3925317
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Neutrophil Cytosol Factor 1 (NCF1)
Species:
Human
Synonyms:
NCF1, Ncf1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948169

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3925314
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to NCF1

  • neutrophil cytosolic factor 1 (NCF1)
  • neutrophil cytosolic factor 1 (Ncf1)
  • Ncf-1
  • NCF1A
  • NOXO2
  • p47
  • p47phox
  • SH3PXD1A

Gene-IDs for different species

GENE IDSPECIES
653361 Homo sapiens
17969 Mus musculus
114553 Rattus norvegicus
281345 Bos taurus
100008803 Oryctolagus cuniculus
100134857 Sus scrofa
607700 Canis lupus familiaris

Protein level used designations for NCF1

  • 47 kDa autosomal chronic granulomatous disease protein
  • 47 kDa neutrophil oxidase factor
  • NADPH oxidase organizer 2
  • NCF-1
  • NCF-47K
  • SH3 and PX domain-containing protein 1A
  • neutrophil NADPH oxidase factor 1
  • neutrophil cytosol factor 1
  • neutrophil cytosolic factor 1, (chronic granulomatous disease, autosomal 1)
  • nox organizer 2
  • nox-organizing protein 2
  • p47-phox
  • NADPH oxidase subunit (47 kD)
  • NADPH oxidase subunit (47kDa)
  • phagocyte oxidase 47 kDa
  • neutrophil cytosolic factor 1 (47kDa, chronic granulomatous disease, autosomal 1)
  • NADPH oxidase p47-phox
  • predicted neutrophil cytosolic factor 1
Other products related to NCF1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com