NCF2 (Neutrophil Cytosolic Factor 2, NCF2)

Short Description: This gene encodes neutrophil cytosolic factor 2, the 67-kilodalton cytosolic subunit of the multi-protein NADPH oxidase complex found in neutrophils. This oxidase produces a burst of superoxide which is delivered to the lumen of the neutrophil phagosome. Mutations in this gene, as well as in other NADPH oxidase subunits, can result in chronic granulomatous disease, a disease that causes recurrent infections by catalase-positive organisms. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2010].
More information related to gene NCF2.
Products related to NCF2 Gene:
133 Products
Type
  • 129
  • 4
Species
  • 58
  • 43
  • 26
  • 2
  • 2
Application
  • 85
  • 27
  • 24
  • 16
  • 1
Fusion tag
  • 42
  • 23
  • 17
  • 11
  • 8
Vector Backbone
  • 10
  • 10
  • 7
  • 6
  • 6
Vector
  • 54
  • 44
  • 12
  • 9
  • 5
Insert
  • 53
  • 39
  • 21
  • 8
  • 6
Oligo-Type
  • 3
  • 1
Resistance Gene
  • 51
  • 45
  • 28
  • 5
  • 2
Expression Type
  • 109
  • 56
  • 13
Selectable Marker
  • 31
  • 26
  • 13
  • 1
Promoter
  • 47
  • 31
  • 28
  • 13
  • 8
Format
  • 64
  • 27
  • 24
  • 18
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Neutrophil Cytosolic Factor 2 (NCF2)
Species:
Human
Synonyms:
NCF2, ncf2.L, ncf2, p67phox, VDBG_06643, PGTG_05816, LOC100136240, Ncf2
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5735260
$147.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Neutrophil Cytosolic Factor 2 (NCF2)
Gene ID:
562473 (Zebrafish (Danio rerio), NCF2)
Synonyms:
NCF2, ncf2.L, ncf2, p67phox, VDBG_06643, PGTG_05816, LOC100136240, Ncf2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6.1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3878306
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Neutrophil Cytosolic Factor 2 (NCF2)
Gene ID:
444487 (Xenopus laevis, NCF2)
Synonyms:
NCF2, ncf2.L, ncf2, p67phox, VDBG_06643, PGTG_05816, LOC100136240, Ncf2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3850534
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Neutrophil Cytosolic Factor 2 (NCF2)
Gene ID:
619367 (Xenopus tropicalis, NCF2)
Synonyms:
NCF2, ncf2.L, ncf2, p67phox, VDBG_06643, PGTG_05816, LOC100136240, Ncf2
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4067501
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Neutrophil Cytosolic Factor 2 (NCF2)
Gene ID:
4688 (Human, NCF2)
Synonyms:
NCF2, ncf2.L, ncf2, p67phox, VDBG_06643, PGTG_05816, LOC100136240, Ncf2
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4085522
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Neutrophil Cytosolic Factor 2 (NCF2)
Gene ID:
17970 (Mouse (Murine), NCF2)
Synonyms:
NCF2, ncf2.L, ncf2, p67phox, VDBG_06643, PGTG_05816, LOC100136240, Ncf2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4216230
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Neutrophil Cytosolic Factor 2 (NCF2)
NCBI Accession:
NM_010877
Species:
Mouse (Murine)
Synonyms:
NCF2, ncf2.L, ncf2, p67phox, VDBG_06643, PGTG_05816, LOC100136240, Ncf2
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3562716
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Application:
Quantitative real-time PCR
Gene:
Neutrophil Cytosolic Factor 2
Species:
Mouse (Murine)
Synonyms:
MGC81877, zgc:158405, noxa2, p67-phox, p67phox, NCF-2, NOXA2, P67-PHOX, P67PHOX, Ncf-2
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3195878
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Neutrophil Cytosolic Factor 2 (NCF2)
Gene ID:
562473 (Zebrafish (Danio rerio), NCF2)
Synonyms:
NCF2, ncf2.L, ncf2, p67phox, VDBG_06643, PGTG_05816, LOC100136240, Ncf2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3865301
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Neutrophil Cytosolic Factor 2 (NCF2)
Gene ID:
444487 (Xenopus laevis, NCF2)
Synonyms:
NCF2, ncf2.L, ncf2, p67phox, VDBG_06643, PGTG_05816, LOC100136240, Ncf2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3850535
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Neutrophil Cytosolic Factor 2 (NCF2)
Gene ID:
619367 (Xenopus tropicalis, NCF2)
Synonyms:
NCF2, ncf2.L, ncf2, p67phox, VDBG_06643, PGTG_05816, LOC100136240, Ncf2
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4067502
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Neutrophil Cytosolic Factor 2 (NCF2)
Gene ID:
4688 (Human, NCF2)
Synonyms:
NCF2, ncf2.L, ncf2, p67phox, VDBG_06643, PGTG_05816, LOC100136240, Ncf2
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4085521
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Neutrophil Cytosolic Factor 2 (NCF2)
Gene ID:
17970 (Mouse (Murine), NCF2)
Synonyms:
NCF2, ncf2.L, ncf2, p67phox, VDBG_06643, PGTG_05816, LOC100136240, Ncf2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4216229
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Neutrophil Cytosolic Factor 2 (NCF2)
Gene ID:
4688 (Human, NCF2)
Synonyms:
NCF2, ncf2.L, ncf2, p67phox, VDBG_06643, PGTG_05816, LOC100136240, Ncf2
Insert length:
1581 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5313517
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
Neutrophil Cytosolic Factor 2 (NCF2)
NCBI Accession:
NM_000433,NP_000424
Species:
Human
Synonyms:
NCF2, ncf2.L, ncf2, p67phox, VDBG_06643, PGTG_05816, LOC100136240, Ncf2
Insert length:
2440 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3379073
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
Neutrophil Cytosolic Factor 2 (NCF2)
NCBI Accession:
NM_000433,NP_000424
Species:
Human
Synonyms:
NCF2, ncf2.L, ncf2, p67phox, VDBG_06643, PGTG_05816, LOC100136240, Ncf2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, Stable

Empty vector controls:
ABIN4948179

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3317919
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
Neutrophil Cytosolic Factor 2 (NCF2)
Species:
Human
Synonyms:
NCF2, ncf2.L, ncf2, p67phox, VDBG_06643, PGTG_05816, LOC100136240, Ncf2
Insert length:
1581 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4478532
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Neutrophil Cytosolic Factor 2 (NCF2)
Species:
Human
Synonyms:
NCF2, ncf2.L, ncf2, p67phox, VDBG_06643, PGTG_05816, LOC100136240, Ncf2
Insert length:
1581 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4622003
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Neutrophil Cytosolic Factor 2 (NCF2)
Species:
Human
Synonyms:
NCF2, ncf2.L, ncf2, p67phox, VDBG_06643, PGTG_05816, LOC100136240, Ncf2
Insert length:
1581 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4770200
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
Neutrophil Cytosolic Factor 2 (NCF2)
Species:
Human
Synonyms:
NCF2, ncf2.L, ncf2, p67phox, VDBG_06643, PGTG_05816, LOC100136240, Ncf2
Insert length:
1581 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4439627
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to NCF2

  • neutrophil cytosolic factor 2 (NCF2)
  • neutrophil cytosolic factor 2 L homeolog (ncf2.L)
  • neutrophil cytosolic factor 2 (ncf2)
  • neutrophil cytosolic factor 2 (p67phox)
  • neutrophil cytosol factor 2 (VDBG_06643)
  • hypothetical protein (PGTG_05816)
  • neutrophil cytosolic factor 2 (LOC100136240)
  • neutrophil cytosolic factor 2 (Ncf2)
  • MGC81877
  • NCF-2
  • Ncf-2
  • noxa2
  • NOXA2
  • p67-phox
  • P67-PHOX
  • p67phox
  • P67PHOX
  • zgc:158405

Gene-IDs for different species

GENE IDSPECIES
424445 Gallus gallus
444487 Xenopus laevis
457573 Pan troglodytes
480036 Canis lupus familiaris
562473 Danio rerio
619224 Ciona intestinalis
619367 Xenopus (Silurana) tropicalis
9537124 Verticillium alfalfae VaMs.102
10531323 Puccinia graminis f. sp. tritici CRL 75-36-700-3
100008802 Oryctolagus cuniculus
100136240 Oncorhynchus mykiss
100142665 Sus scrofa
100174692 Pongo abelii
100270811 Salmo salar
4688 Homo sapiens
17970 Mus musculus
364018 Rattus norvegicus
281346 Bos taurus

Protein level used designations for NCF2

  • neutrophil cytosolic factor 2 (65kDa, chronic granulomatous disease, autosomal 2)
  • neutrophil cytosolic factor 2
  • neutrophil cytosol factor 2
  • predicted neutrophil cytosolic factor 2
  • p67phox
  • p67-phox
  • NADPH oxidase cytosolic protein p67phox
  • NADPH oxidase cytosolic protein
  • 67 kDa neutrophil oxidase factor
  • NADPH oxidase activator 2
  • chronic granulomatous disease, autosomal 2
  • neutrophil NADPH oxidase factor 2
  • neutrophil cytosolic factor 2 (65kD, chronic granulomatous disease, autosomal 2)
  • NADPH oxidase subunit (67 kD)
  • NADPH oxidase subunit (67kDa)
  • NCF-2
Other products related to NCF2 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com