NCOA4 (Nuclear Receptor Coactivator 4, NCOA4)

Short Description: This gene encodes an androgen receptor coactivator. The encoded protein interacts with the androgen receptor in a ligand-dependent manner to enhance its transcriptional activity. Chromosomal translocations between this gene and the ret tyrosine kinase gene, also located on chromosome 10, have been associated with papillary thyroid carcinoma. Alternatively spliced transcript variants have been described. Pseudogenes are present on chromosomes 4, 5, 10, and 14. [provided by RefSeq, Feb 2009].
More information related to gene NCOA4.
Products related to NCOA4 Gene:
198 Products
Type
  • 195
  • 3
Species
  • 94
  • 60
  • 38
  • 3
  • 2
Application
  • 136
  • 51
  • 20
  • 16
Fusion tag
  • 64
  • 26
  • 23
  • 22
  • 10
Vector Backbone
  • 17
  • 14
  • 14
  • 6
  • 6
Vector
  • 93
  • 50
  • 24
  • 12
  • 9
Insert
  • 83
  • 79
  • 17
  • 8
  • 6
Oligo-Type
  • 3
Resistance Gene
  • 97
  • 53
  • 36
  • 9
  • 2
Expression Type
  • 156
  • 65
  • 26
Selectable Marker
  • 50
  • 26
  • 24
  • 1
Promoter
  • 68
  • 53
  • 29
  • 25
  • 8
Format
  • 92
  • 54
  • 27
  • 25
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Nuclear Receptor Coactivator 4 (NCOA4)
Species:
Human
Synonyms:
Ncoa4, ncoa4, NCOA4, ncoa4.S
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5732034
$147.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Nuclear Receptor Coactivator 4 (NCOA4)
Species:
Human
Synonyms:
Ncoa4, ncoa4, NCOA4, ncoa4.S
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5732033
$147.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Nuclear Receptor Coactivator 4 (NCOA4)
NCBI Accession:
NM_001145261,NP_001138733
Species:
Human
Synonyms:
Ncoa4, ncoa4, NCOA4, ncoa4.S
Insert length:
1893 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5373865
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Nuclear Receptor Coactivator 4 (NCOA4)
NCBI Accession:
NM_001145261
Gene ID:
8031 (Human, NCOA4)
Synonyms:
Ncoa4, ncoa4, NCOA4, ncoa4.S
Insert length:
1893 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4926755
$99.00
10 μg
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Nuclear Receptor Coactivator 4 (NCOA4)
Gene ID:
394104 (Zebrafish (Danio rerio), NCOA4)
Synonyms:
Ncoa4, ncoa4, NCOA4, ncoa4.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6.1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3877711
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Nuclear Receptor Coactivator 4 (NCOA4)
Gene ID:
394104 (Zebrafish (Danio rerio), NCOA4)
Synonyms:
Ncoa4, ncoa4, NCOA4, ncoa4.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4074552
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Nuclear Receptor Coactivator 4 (NCOA4)
Gene ID:
27057 (Mouse (Murine), NCOA4)
Synonyms:
Ncoa4, ncoa4, NCOA4, ncoa4.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3812815
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Nuclear Receptor Coactivator 4 (NCOA4)
Gene ID:
8031 (Human, NCOA4)
Synonyms:
Ncoa4, ncoa4, NCOA4, ncoa4.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3805969
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Nuclear Receptor Coactivator 4 (NCOA4)
Gene ID:
27057 (Mouse (Murine), NCOA4)
Synonyms:
Ncoa4, ncoa4, NCOA4, ncoa4.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6.1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3875666
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Nuclear Receptor Coactivator 4 (NCOA4)
Gene ID:
619385 (Rat (Rattus), NCOA4)
Synonyms:
Ncoa4, ncoa4, NCOA4, ncoa4.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4067507
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Nuclear Receptor Coactivator 4 (NCOA4)
Gene ID:
525329 (Cow (Bovine), NCOA4)
Synonyms:
Ncoa4, ncoa4, NCOA4, ncoa4.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4063613
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Nuclear Receptor Coactivator 4 (NCOA4)
Gene ID:
8031 (Human, NCOA4)
Synonyms:
Ncoa4, ncoa4, NCOA4, ncoa4.S
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4087575
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Nuclear Receptor Coactivator 4 (NCOA4)
Gene ID:
734285 (Xenopus laevis, NCOA4)
Synonyms:
Ncoa4, ncoa4, NCOA4, ncoa4.S
Vector type:
Cloning Vector
Vector backbone:
pBluescript SK-
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4210626
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Nuclear Receptor Coactivator 4 (NCOA4)
NCBI Accession:
NM_001033988
Species:
Mouse (Murine)
Synonyms:
Ncoa4, ncoa4, NCOA4, ncoa4.S
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3562722
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Nuclear Receptor Coactivator 4 (NCOA4)
Species:
Human
Synonyms:
Ncoa4, ncoa4, NCOA4, ncoa4.S
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3562721
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Nuclear Receptor Coactivator 4 (NCOA4)
NCBI Accession:
NM_001034008
Species:
Rat (Rattus)
Synonyms:
Ncoa4, ncoa4, NCOA4, ncoa4.S
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3562723
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Nuclear Receptor Coactivator 4 (NCOA4)
Gene ID:
394104 (Zebrafish (Danio rerio), NCOA4)
Synonyms:
Ncoa4, ncoa4, NCOA4, ncoa4.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3845092
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Nuclear Receptor Coactivator 4 (NCOA4)
Gene ID:
27057 (Mouse (Murine), NCOA4)
Synonyms:
Ncoa4, ncoa4, NCOA4, ncoa4.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3812813
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Nuclear Receptor Coactivator 4 (NCOA4)
Gene ID:
27057 (Mouse (Murine), NCOA4)
Synonyms:
Ncoa4, ncoa4, NCOA4, ncoa4.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3812814
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Nuclear Receptor Coactivator 4 (NCOA4)
Gene ID:
8031 (Human, NCOA4)
Synonyms:
Ncoa4, ncoa4, NCOA4, ncoa4.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3805970
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to NCOA4

  • nuclear receptor coactivator 4 (Ncoa4)
  • nuclear receptor coactivator 4 (ncoa4)
  • nuclear receptor coactivator 4 (NCOA4)
  • nuclear receptor coactivator 4 S homeolog (ncoa4.S)
  • 1110034E15Rik
  • 4432406M01Rik
  • AI227008
  • ara70
  • ARA70
  • DKFZp459B2429
  • DKFZp469A035
  • DKFZp469A1925
  • ele1
  • ELE1
  • MGC84996
  • MGC138109
  • NCOA4
  • ncoa4
  • ptc3
  • PTC3
  • Rfg
  • RFG
  • rfg
  • zgc:55307
  • zgc:77270

Gene-IDs for different species

GENE IDSPECIES
619385 Rattus norvegicus
394104 Danio rerio
423615 Gallus gallus
450455 Pan troglodytes
525329 Bos taurus
734285 Xenopus laevis
100156184 Sus scrofa
100172727 Pongo abelii
100306816 Salmo salar
8031 Homo sapiens
27057 Mus musculus

Protein level used designations for NCOA4

  • nuclear receptor coactivator 4
  • Nuclear receptor coactivator 4
  • 70 kDa AR-activator
  • 70 kDa androgen receptor coactivator
  • NCoA-4
  • RET-activating gene ELE1
  • androgen receptor-associated protein of 70 kDa
  • ret fused
Other products related to NCOA4 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com