NCOA4 (Nuclear Receptor Coactivator 4, NCOA4)

Short Description: This gene encodes an androgen receptor coactivator. The encoded protein interacts with the androgen receptor in a ligand-dependent manner to enhance its transcriptional activity. Chromosomal translocations between this gene and the ret tyrosine kinase gene, also located on chromosome 10, have been associated with papillary thyroid carcinoma. Alternatively spliced transcript variants have been described. Pseudogenes are present on chromosomes 4, 5, 10, and 14. [provided by RefSeq, Feb 2009].
More information related to gene NCOA4.
Products related to NCOA4 Gene:
198 Products
  • 195
  • 3
  • 94
  • 60
  • 38
  • 3
  • 2
  • 136
  • 51
  • 20
  • 16
Fusion tag
  • 64
  • 26
  • 23
  • 22
  • 10
Vector Backbone
  • 17
  • 14
  • 14
  • 6
  • 6
  • 93
  • 50
  • 24
  • 12
  • 9
  • 83
  • 79
  • 17
  • 8
  • 6
  • 3
Resistance Gene
  • 97
  • 53
  • 36
  • 9
  • 2
Expression Type
  • 156
  • 65
  • 26
Selectable Marker
  • 50
  • 26
  • 24
  • 1
  • 68
  • 53
  • 29
  • 25
  • 8
  • 92
  • 54
  • 27
  • 25

Protein Expression
Nuclear Receptor Coactivator 4 (NCOA4)
NCBI Accession:
Ncoa4, ncoa4, NCOA4, ncoa4.S
Insert length:
1893 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5373865
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
ISO 9001:2008

Protein Expression
Nuclear Receptor Coactivator 4 (NCOA4)
NCBI Accession:
Gene ID:
8031 (Human, NCOA4)
Ncoa4, ncoa4, NCOA4, ncoa4.S
Insert length:
1893 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
RT/-20 °C
Catalog No. ABIN4926755
10 μg
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Nuclear Receptor Coactivator 4 (NCOA4)
Gene ID:
394104 (Zebrafish (Danio rerio), NCOA4)
Ncoa4, ncoa4, NCOA4, ncoa4.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3877711
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Nuclear Receptor Coactivator 4 (NCOA4)
Gene ID:
394104 (Zebrafish (Danio rerio), NCOA4)
Ncoa4, ncoa4, NCOA4, ncoa4.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Glycerol Stock
-80 °C
Catalog No. ABIN4074552
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Nuclear Receptor Coactivator 4 (NCOA4)
Gene ID:
27057 (Mouse (Murine), NCOA4)
Ncoa4, ncoa4, NCOA4, ncoa4.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3812815
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Nuclear Receptor Coactivator 4 (NCOA4)
Gene ID:
8031 (Human, NCOA4)
Ncoa4, ncoa4, NCOA4, ncoa4.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3805969
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Nuclear Receptor Coactivator 4 (NCOA4)
Gene ID:
27057 (Mouse (Murine), NCOA4)
Ncoa4, ncoa4, NCOA4, ncoa4.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3875666
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Nuclear Receptor Coactivator 4 (NCOA4)
Gene ID:
619385 (Rat (Rattus), NCOA4)
Ncoa4, ncoa4, NCOA4, ncoa4.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4067507
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Nuclear Receptor Coactivator 4 (NCOA4)
Gene ID:
525329 (Cow (Bovine), NCOA4)
Ncoa4, ncoa4, NCOA4, ncoa4.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4063613
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Nuclear Receptor Coactivator 4 (NCOA4)
Gene ID:
8031 (Human, NCOA4)
Ncoa4, ncoa4, NCOA4, ncoa4.S
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4087575
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Nuclear Receptor Coactivator 4 (NCOA4)
Gene ID:
734285 (Xenopus laevis, NCOA4)
Ncoa4, ncoa4, NCOA4, ncoa4.S
Vector type:
Cloning Vector
Vector backbone:
pBluescript SK-
Resistance Gene:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4210626
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Nuclear Receptor Coactivator 4 (NCOA4)
NCBI Accession:
Mouse (Murine)
Ncoa4, ncoa4, NCOA4, ncoa4.S
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13(-21)
  • M13 rev
Catalog No. ABIN3562722
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Nuclear Receptor Coactivator 4 (NCOA4)
Ncoa4, ncoa4, NCOA4, ncoa4.S
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13(-21)
  • M13 rev
Catalog No. ABIN3562721
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Nuclear Receptor Coactivator 4 (NCOA4)
NCBI Accession:
Rat (Rattus)
Ncoa4, ncoa4, NCOA4, ncoa4.S
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13(-21)
  • M13 rev
Catalog No. ABIN3562723
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Protein Expression, Cloning
Nuclear Receptor Coactivator 4 (NCOA4)
Gene ID:
394104 (Zebrafish (Danio rerio), NCOA4)
Ncoa4, ncoa4, NCOA4, ncoa4.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3845092
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Nuclear Receptor Coactivator 4 (NCOA4)
Ncoa4, ncoa4, NCOA4, ncoa4.S
Insert length:
1728 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5732033
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Nuclear Receptor Coactivator 4 (NCOA4)
Ncoa4, ncoa4, NCOA4, ncoa4.S
Insert length:
1845 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5732034
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Protein Expression, Cloning
Nuclear Receptor Coactivator 4 (NCOA4)
Gene ID:
27057 (Mouse (Murine), NCOA4)
Ncoa4, ncoa4, NCOA4, ncoa4.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3812813
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Nuclear Receptor Coactivator 4 (NCOA4)
Gene ID:
27057 (Mouse (Murine), NCOA4)
Ncoa4, ncoa4, NCOA4, ncoa4.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3812814
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Nuclear Receptor Coactivator 4 (NCOA4)
Gene ID:
8031 (Human, NCOA4)
Ncoa4, ncoa4, NCOA4, ncoa4.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3805970
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to NCOA4

  • nuclear receptor coactivator 4 (Ncoa4)
  • nuclear receptor coactivator 4 (ncoa4)
  • nuclear receptor coactivator 4 (NCOA4)
  • nuclear receptor coactivator 4 S homeolog (ncoa4.S)
  • 1110034E15Rik
  • 4432406M01Rik
  • AI227008
  • ara70
  • ARA70
  • DKFZp459B2429
  • DKFZp469A035
  • DKFZp469A1925
  • ele1
  • ELE1
  • MGC84996
  • MGC138109
  • NCOA4
  • ncoa4
  • ptc3
  • PTC3
  • Rfg
  • RFG
  • rfg
  • zgc:55307
  • zgc:77270

Gene-IDs for different species

619385 Rattus norvegicus
394104 Danio rerio
423615 Gallus gallus
450455 Pan troglodytes
525329 Bos taurus
734285 Xenopus laevis
100156184 Sus scrofa
100172727 Pongo abelii
100306816 Salmo salar
8031 Homo sapiens
27057 Mus musculus

Protein level used designations for NCOA4

  • nuclear receptor coactivator 4
  • Nuclear receptor coactivator 4
  • 70 kDa AR-activator
  • 70 kDa androgen receptor coactivator
  • NCoA-4
  • RET-activating gene ELE1
  • androgen receptor-associated protein of 70 kDa
  • ret fused
Other products related to NCOA4 such as antibodies, ELISA kits and high-purity proteins are available on our partner website