NCR1 (Natural Cytotoxicity Triggering Receptor 1, NCR1)

Short Description: has similarity to immunoglobulins\; expressed in NK cells [RGD, Feb 2006].
More information related to gene NCR1.
Products related to NCR1 Gene:
151 Products
Type
  • 145
  • 6
Species
  • 69
  • 40
  • 30
  • 12
Application
  • 99
  • 24
  • 23
  • 16
  • 3
Fusion tag
  • 42
  • 22
  • 16
  • 15
  • 11
Vector Backbone
  • 10
  • 8
  • 8
  • 6
  • 6
Vector
  • 73
  • 40
  • 12
  • 9
  • 5
Insert
  • 72
  • 36
  • 21
  • 8
  • 6
Oligo-Type
  • 3
  • 3
Resistance Gene
  • 72
  • 45
  • 22
  • 6
  • 2
Expression Type
  • 104
  • 58
  • 33
Selectable Marker
  • 35
  • 33
  • 26
  • 2
  • 1
Promoter
  • 47
  • 43
  • 31
  • 13
  • 8
Format
  • 91
  • 27
  • 22
  • 11

Type:
ORF
Application:
Cloning
Gene:
Natural Cytotoxicity Triggering Receptor 1 (NCR1)
Species:
Human
Synonyms:
NCR1, Ncr1
Insert length:
912 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5735315
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Natural Cytotoxicity Triggering Receptor 1 (NCR1)
NCBI Accession:
NM_001242357
Gene ID:
9437 (Human, NCR1)
Synonyms:
NCR1, Ncr1
Insert length:
579 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4926751
$99.00
10 μg
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Natural Cytotoxicity Triggering Receptor 1 (NCR1)
Gene ID:
17086 (Mouse (Murine), NCR1)
Synonyms:
NCR1, Ncr1
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3988292
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Natural Cytotoxicity Triggering Receptor 1 (NCR1)
Gene ID:
9437 (Human, NCR1)
Synonyms:
NCR1, Ncr1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3465897
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Natural Cytotoxicity Triggering Receptor 1 (NCR1)
Species:
Rhesus Monkey
Synonyms:
NCR1, Ncr1
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN4104225
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Natural Cytotoxicity Triggering Receptor 1 (NCR1)
Species:
Human
Synonyms:
NCR1, Ncr1
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3888658
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Natural Cytotoxicity Triggering Receptor 1 (NCR1)
NCBI Accession:
NM_057199
Species:
Rat (Rattus)
Synonyms:
NCR1, Ncr1
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6
  • T7
  • M13-47
  • RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3888659
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Natural Cytotoxicity Triggering Receptor 1
Species:
Human
Synonyms:
CD335, LY94, NK-p46, NKP46, Ly94, NKp46, KILR-1, Nk-p46, Nkp46
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3190782
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Natural Cytotoxicity Triggering Receptor 1
Species:
Mouse (Murine)
Synonyms:
CD335, LY94, NK-p46, NKP46, Ly94, NKp46, KILR-1, Nk-p46, Nkp46
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3194233
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Natural Cytotoxicity Triggering Receptor 1
Species:
Rat (Rattus)
Synonyms:
CD335, LY94, NK-p46, NKP46, Ly94, NKp46, KILR-1, Nk-p46, Nkp46
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3196509
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Natural Cytotoxicity Triggering Receptor 1 (NCR1)
Gene ID:
17086 (Mouse (Murine), NCR1)
Synonyms:
NCR1, Ncr1
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3988291
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Natural Cytotoxicity Triggering Receptor 1 (NCR1)
Gene ID:
9437 (Human, NCR1)
Synonyms:
NCR1, Ncr1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3465898
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Natural Cytotoxicity Triggering Receptor 1 (NCR1)
Gene ID:
9437 (Human, NCR1)
Synonyms:
NCR1, Ncr1
Insert length:
912 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5320687
$189.37
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Natural Cytotoxicity Triggering Receptor 1 (NCR1)
NCBI Accession:
NM_001242356
Gene ID:
9437 (Human, NCR1)
Synonyms:
NCR1, Ncr1
Insert length:
630 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4926750
$199.00
10 μg
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Natural Cytotoxicity Triggering Receptor 1 (NCR1)
NCBI Accession:
NM_057199
Species:
Rat (Rattus)
Synonyms:
NCR1, Ncr1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-untagged
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948161

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3925404
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Natural Cytotoxicity Triggering Receptor 1 (NCR1)
Species:
Human
Synonyms:
NCR1, Ncr1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948165

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3925386
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Natural Cytotoxicity Triggering Receptor 1 (NCR1)
Species:
Human
Synonyms:
NCR1, Ncr1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3925383
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Natural Cytotoxicity Triggering Receptor 1 (NCR1)
Species:
Human
Synonyms:
NCR1, Ncr1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948163

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3925385
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Natural Cytotoxicity Triggering Receptor 1 (NCR1)
Species:
Human
Synonyms:
NCR1, Ncr1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948164

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3925387
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Natural Cytotoxicity Triggering Receptor 1 (NCR1)
Species:
Human
Synonyms:
NCR1, Ncr1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948171

Sequencing Primer:
  • T7 (TAATACGACTCACTATAGGG)
  • BGH (TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3925390
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to NCR1

  • natural cytotoxicity triggering receptor 1 (NCR1)
  • natural cytotoxicity triggering receptor 1 (Ncr1)
  • CD335
  • KILR-1
  • LY94
  • Ly94
  • NK-p46
  • Nk-p46
  • NKP46
  • NKp46
  • Nkp46

Gene-IDs for different species

GENE IDSPECIES
9437 Homo sapiens
17086 Mus musculus
117547 Rattus norvegicus
611390 Canis lupus familiaris
100141419 Sus scrofa
369024 Bos taurus

Protein level used designations for NCR1

  • NK cell-activating receptor
  • lymphocyte antigen 94 homolog (activating NK-receptor; NK-p46)
  • natural killer cell p46-related protein
  • MAR1 (mouse activating receptor 1)
  • NK-p46
  • activating receptor 1
  • lymphocyte antigen 94
  • mAR-1
  • mNKp46
  • NK receptor KILR-1
  • NK-p46)
  • NKACTR
  • lymphocyte antigen 94 homolog (activating NK-receptor
  • rAR-1
  • rat-activating receptor 1
Other products related to NCR1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com