NDRG2 (NDRG Family Member 2, NDRG2)

Short Description: This gene is a member of the N-myc downregulated gene family which belongs to the alpha/beta hydrolase superfamily. The protein encoded by this gene is a cytoplasmic protein that may play a role in neurite outgrowth. This gene may be involved in glioblastoma carcinogenesis. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008].
More information related to gene NDRG2.
Products related to NDRG2 Gene:
  • 238
  • 6
  • 121
  • 55
  • 46
  • 14
  • 2
  • 188
  • 42
  • 21
  • 16
  • 3
Fusion tag
  • 65
  • 39
  • 33
  • 23
  • 14
  • 14
Vector Backbone
  • 30
  • 19
  • 19
  • 8
  • 8
  • 137
  • 62
  • 20
  • 9
  • 4
  • 128
  • 76
  • 18
  • 8
  • 6
  • 3
  • 3
Resistance Gene
  • 123
  • 68
  • 44
  • 3
  • 2
Expression Type
  • 175
  • 69
  • 53
Selectable Marker
  • 54
  • 53
  • 26
  • 1
  • 90
  • 84
  • 28
  • 22
  • 8
  • 149
  • 40
  • 32
  • 23
244 Products

Protein Expression
NDRG Family Member 2 (NDRG2)
NCBI Accession:
ndrg2, NDRG2, Ndrg2, ndrg2.S
Insert length:
1116 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5357165
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

NDRG Family Member 2 (NDRG2)
Gene ID:
57447 (Human, NDRG2)
ndrg2, NDRG2, Ndrg2, ndrg2.S
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3469825
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
NDRG Family Member 2 (NDRG2)
Gene ID:
493281 (Xenopus tropicalis, NDRG2)
ndrg2, NDRG2, Ndrg2, ndrg2.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3885762
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
NDRG Family Member 2 (NDRG2)
Gene ID:
380081 (Xenopus laevis, NDRG2)
ndrg2, NDRG2, Ndrg2, ndrg2.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3843638
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
NDRG Family Member 2 (NDRG2)
Gene ID:
57447 (Human, NDRG2)
ndrg2, NDRG2, Ndrg2, ndrg2.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3818019
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
NDRG Family Member 2 (NDRG2)
Gene ID:
57447 (Human, NDRG2)
ndrg2, NDRG2, Ndrg2, ndrg2.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3818020
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
NDRG Family Member 2 (NDRG2)
Gene ID:
29811 (Mouse (Murine), NDRG2)
ndrg2, NDRG2, Ndrg2, ndrg2.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3813473
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
NDRG Family Member 2 (NDRG2)
Gene ID:
515063 (Cow (Bovine), NDRG2)
ndrg2, NDRG2, Ndrg2, ndrg2.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4062968
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

NDRG Family Member 2 (NDRG2)
ndrg2, NDRG2, Ndrg2, ndrg2.S
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Catalog No. ABIN3562737
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

NDRG Family Member 2 (NDRG2)
NCBI Accession:
ndrg2, NDRG2, Ndrg2, ndrg2.S
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Catalog No. ABIN3561937
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

NDRG Family Member 2 (NDRG2)
NCBI Accession:
Mouse (Murine)
ndrg2, NDRG2, Ndrg2, ndrg2.S
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13(-21)
  • M13 rev
Catalog No. ABIN3887405
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

NDRG Family Member 2 (NDRG2)
NCBI Accession:
Rat (Rattus)
ndrg2, NDRG2, Ndrg2, ndrg2.S
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13(-21)
  • M13 rev
Catalog No. ABIN3887406
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Quantitative real-time PCR
NDRG Family Member 2
Mouse (Murine)
NDRG2, AI182517, AU040374, Ndr2, SYLD, im:6909381, si:dkey-88n24.1, zgc:101847
-20 °C
Catalog No. ABIN3195400
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Quantitative real-time PCR
NDRG Family Member 2
Rat (Rattus)
NDRG2, AI182517, AU040374, Ndr2, SYLD, im:6909381, si:dkey-88n24.1, zgc:101847
-20 °C
Catalog No. ABIN3197253
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Quantitative real-time PCR
NDRG Family Member 2
NDRG2, AI182517, AU040374, Ndr2, SYLD, im:6909381, si:dkey-88n24.1, zgc:101847
-20 °C
Catalog No. ABIN3191170
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

NDRG Family Member 2 (NDRG2)
Gene ID:
57447 (Human, NDRG2)
ndrg2, NDRG2, Ndrg2, ndrg2.S
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3469824
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
NDRG Family Member 2 (NDRG2)
Gene ID:
493281 (Xenopus tropicalis, NDRG2)
ndrg2, NDRG2, Ndrg2, ndrg2.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3885763
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
NDRG Family Member 2 (NDRG2)
Gene ID:
380081 (Xenopus laevis, NDRG2)
ndrg2, NDRG2, Ndrg2, ndrg2.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3843639
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
NDRG Family Member 2 (NDRG2)
Gene ID:
57447 (Human, NDRG2)
ndrg2, NDRG2, Ndrg2, ndrg2.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3818018
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
NDRG Family Member 2 (NDRG2)
Gene ID:
57447 (Human, NDRG2)
ndrg2, NDRG2, Ndrg2, ndrg2.S
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3818021
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1
  • ...
  • ...

Synonyms and alternative names related to NDRG2

  • NDRG family member 2 (ndrg2)
  • NDRG family member 2 (NDRG2)
  • N-myc downstream regulated gene 2 (Ndrg2)
  • NDRG family member 2 S homeolog (ndrg2.S)
  • NDRG family member 2 (Ndrg2)
  • AI182517
  • AU040374
  • im:6909381
  • Ndr2
  • NDRG2
  • si:dkey-88n24.1
  • SYLD
  • zgc:101847

Gene-IDs for different species

493281 Xenopus (Silurana) tropicalis
706990 Macaca mulatta
100351595 Oryctolagus cuniculus
29811 Mus musculus
494050 Danio rerio
380081 Xenopus laevis
57447 Homo sapiens
609390 Canis lupus familiaris
515063 Bos taurus
171114 Rattus norvegicus
100174656 Pongo abelii
100499579 Pan troglodytes
780431 Sus scrofa

Protein level used designations for NDRG2

  • protein NDRG2
  • NDRG family member 2
  • N-myc downstream-regulated gene 2
  • N-myc downstream regulated 2
  • N-myc downstream-regulated gene 2 protein
  • protein Ndr2
  • N-myc downstream regulator 2
  • NDR1-related protein NDR2
  • cytoplasmic protein Ndr1
  • syld709613 protein
  • N-myc downstream regulated gene 2
  • NDRG1-related protein
  • antidepressant-related protein ADRG123
  • N-Myc downstream regulated gene 2
Other products related to NDRG2 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com