NDRG2 (NDRG Family Member 2, NDRG2)

Short Description: This gene is a member of the N-myc downregulated gene family which belongs to the alpha/beta hydrolase superfamily. The protein encoded by this gene is a cytoplasmic protein that may play a role in neurite outgrowth. This gene may be involved in glioblastoma carcinogenesis. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008].
More information related to gene NDRG2.
Products related to NDRG2 Gene:
248 Products
Data Quality
  • 4
Type
  • 241
  • 7
Species
  • 123
  • 56
  • 47
  • 14
  • 2
Application
  • 188
  • 42
  • 25
  • 16
  • 3
Fusion tag
  • 66
  • 39
  • 36
  • 23
  • 14
Vector Backbone
  • 30
  • 19
  • 19
  • 8
  • 8
Vector
  • 140
  • 62
  • 20
  • 9
  • 4
Insert
  • 128
  • 76
  • 21
  • 8
  • 6
Oligo-Type
  • 4
  • 3
Resistance Gene
  • 126
  • 68
  • 44
  • 3
  • 2
Expression Type
  • 178
  • 72
  • 53
Selectable Marker
  • 57
  • 53
  • 26
  • 1
Promoter
  • 93
  • 84
  • 31
  • 22
  • 8
Format
  • 153
  • 40
  • 32
  • 23
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
NDRG Family Member 2 (NDRG2)
NCBI Accession:
NM_201537,NP_963831
Species:
Human
Synonyms:
ndrg2, NDRG2, Ndrg2, ndrg2.S
Insert length:
1116 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5357165
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
NDRG Family Member 2 (NDRG2)
Gene ID:
380081 (Xenopus laevis, NDRG2)
Synonyms:
ndrg2, NDRG2, Ndrg2, ndrg2.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3843638
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
NDRG Family Member 2 (NDRG2)
Gene ID:
29811 (Mouse (Murine), NDRG2)
Synonyms:
ndrg2, NDRG2, Ndrg2, ndrg2.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3813473
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
NDRG Family Member 2 (NDRG2)
Gene ID:
57447 (Human, NDRG2)
Synonyms:
ndrg2, NDRG2, Ndrg2, ndrg2.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3818020
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
NDRG Family Member 2 (NDRG2)
Gene ID:
57447 (Human, NDRG2)
Synonyms:
ndrg2, NDRG2, Ndrg2, ndrg2.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3818019
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
NDRG Family Member 2 (NDRG2)
Gene ID:
493281 (Xenopus tropicalis, NDRG2)
Synonyms:
ndrg2, NDRG2, Ndrg2, ndrg2.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3885762
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
NDRG Family Member 2 (NDRG2)
Gene ID:
515063 (Cow (Bovine), NDRG2)
Synonyms:
ndrg2, NDRG2, Ndrg2, ndrg2.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4062968
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
NDRG Family Member 2 (NDRG2)
Gene ID:
57447 (Human, NDRG2)
Synonyms:
ndrg2, NDRG2, Ndrg2, ndrg2.S
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3469825
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
NDRG Family Member 2 (NDRG2)
NCBI Accession:
NM_133583
Species:
Rat (Rattus)
Synonyms:
ndrg2, NDRG2, Ndrg2, ndrg2.S
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3887406
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
NDRG Family Member 2 (NDRG2)
NCBI Accession:
NM_013864
Species:
Mouse (Murine)
Synonyms:
ndrg2, NDRG2, Ndrg2, ndrg2.S
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3887405
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
NDRG Family Member 2 (NDRG2)
Species:
Human
Synonyms:
ndrg2, NDRG2, Ndrg2, ndrg2.S
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3562737
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
NDRG Family Member 2 (NDRG2)
NCBI Accession:
XM_005560735
Species:
Cynomolgus
Synonyms:
ndrg2, NDRG2, Ndrg2, ndrg2.S
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3561937
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Application:
Quantitative real-time PCR
Gene:
NDRG Family Member 2
Species:
Human
Synonyms:
NDRG2, AI182517, AU040374, Ndr2, SYLD, im:6909381, si:dkey-88n24.1, zgc:101847
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3191170
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Application:
Quantitative real-time PCR
Gene:
NDRG Family Member 2
Species:
Rat (Rattus)
Synonyms:
NDRG2, AI182517, AU040374, Ndr2, SYLD, im:6909381, si:dkey-88n24.1, zgc:101847
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3197253
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Application:
Quantitative real-time PCR
Gene:
NDRG Family Member 2
Species:
Mouse (Murine)
Synonyms:
NDRG2, AI182517, AU040374, Ndr2, SYLD, im:6909381, si:dkey-88n24.1, zgc:101847
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3195400
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
NDRG Family Member 2 (NDRG2)
Gene ID:
380081 (Xenopus laevis, NDRG2)
Synonyms:
ndrg2, NDRG2, Ndrg2, ndrg2.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3843639
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
NDRG Family Member 2 (NDRG2)
Gene ID:
29811 (Mouse (Murine), NDRG2)
Synonyms:
ndrg2, NDRG2, Ndrg2, ndrg2.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3813475
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
NDRG Family Member 2 (NDRG2)
Gene ID:
57447 (Human, NDRG2)
Synonyms:
ndrg2, NDRG2, Ndrg2, ndrg2.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3818018
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
NDRG Family Member 2 (NDRG2)
Gene ID:
57447 (Human, NDRG2)
Synonyms:
ndrg2, NDRG2, Ndrg2, ndrg2.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3818021
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
NDRG Family Member 2 (NDRG2)
Gene ID:
493281 (Xenopus tropicalis, NDRG2)
Synonyms:
ndrg2, NDRG2, Ndrg2, ndrg2.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3885763
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1
  • ...
  • ...

Synonyms and alternative names related to NDRG2

  • NDRG family member 2 (ndrg2)
  • NDRG family member 2 (NDRG2)
  • N-myc downstream regulated gene 2 (Ndrg2)
  • NDRG family member 2 S homeolog (ndrg2.S)
  • NDRG family member 2 (Ndrg2)
  • AI182517
  • AU040374
  • im:6909381
  • Ndr2
  • NDRG2
  • si:dkey-88n24.1
  • SYLD
  • zgc:101847

Gene-IDs for different species

GENE IDSPECIES
493281 Xenopus (Silurana) tropicalis
706990 Macaca mulatta
100351595 Oryctolagus cuniculus
29811 Mus musculus
494050 Danio rerio
380081 Xenopus laevis
57447 Homo sapiens
609390 Canis lupus familiaris
515063 Bos taurus
171114 Rattus norvegicus
100174656 Pongo abelii
100499579 Pan troglodytes
780431 Sus scrofa

Protein level used designations for NDRG2

  • protein NDRG2
  • NDRG family member 2
  • N-myc downstream-regulated gene 2
  • N-myc downstream regulated 2
  • N-myc downstream-regulated gene 2 protein
  • protein Ndr2
  • N-myc downstream regulator 2
  • NDR1-related protein NDR2
  • cytoplasmic protein Ndr1
  • syld709613 protein
  • N-myc downstream regulated gene 2
  • NDRG1-related protein
  • antidepressant-related protein ADRG123
  • N-Myc downstream regulated gene 2
Other products related to NDRG2 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com