OGG1 (8-Oxoguanine DNA Glycosylase, OGG1)

Short Description: This gene encodes the enzyme responsible for the excision of 8-oxoguanine, a mutagenic base byproduct which occurs as a result of exposure to reactive oxygen. The action of this enzyme includes lyase activity for chain cleavage. Alternative splicing of the C-terminal region of this gene classifies splice variants into two major groups, type 1 and type 2, depending on the last exon of the sequence. Type 1 alternative splice variants end with exon 7 and type 2 end with exon 8. All variants share the N-terminal region in common, which contains a mitochondrial targeting signal that is essential for mitochondrial localization. Many alternative splice variants for this gene have been described, but the full-length nature for every variant has not been determined. [provided by RefSeq, Aug 2008].
More information related to gene OGG1.
Products related to OGG1 Gene:
158 Products
  • 155
  • 3
  • 87
  • 30
  • 25
  • 14
  • 2
  • 110
  • 24
  • 22
  • 16
Fusion tag
  • 42
  • 33
  • 27
  • 11
  • 10
Vector Backbone
  • 16
  • 16
  • 16
  • 8
  • 8
  • 67
  • 56
  • 12
  • 9
  • 6
  • 75
  • 43
  • 21
  • 8
  • 6
  • 3
Resistance Gene
  • 60
  • 53
  • 40
  • 2
  • 2
Expression Type
  • 131
  • 65
  • 13
Selectable Marker
  • 49
  • 26
  • 13
  • 1
  • 72
  • 31
  • 26
  • 14
  • 8
  • 90
  • 28
  • 24
  • 16
Supplier: Log in to see

Protein Expression
8-Oxoguanine DNA Glycosylase (OGG1)
NCBI Accession:
OGG1, ogg1.L, ogg1, ECU08_0770, CA_C2707, BBOV_I004290, Smp_074010.1, LOC9329243, Tb927.4.2480, Ogg1
Insert length:
1038 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5391196
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

8-Oxoguanine DNA Glycosylase (OGG1)
Gene ID:
4968 (Human, OGG1)
OGG1, ogg1.L, ogg1, ECU08_0770, CA_C2707, BBOV_I004290, Smp_074010.1, LOC9329243, Tb927.4.2480, Ogg1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4085694
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

8-Oxoguanine DNA Glycosylase (OGG1)
Gene ID:
18294 (Mouse (Murine), OGG1)
OGG1, ogg1.L, ogg1, ECU08_0770, CA_C2707, BBOV_I004290, Smp_074010.1, LOC9329243, Tb927.4.2480, Ogg1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4003358
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

8-Oxoguanine DNA Glycosylase (OGG1)
Gene ID:
18294 (Mouse (Murine), OGG1)
OGG1, ogg1.L, ogg1, ECU08_0770, CA_C2707, BBOV_I004290, Smp_074010.1, LOC9329243, Tb927.4.2480, Ogg1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4003357
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

8-Oxoguanine DNA Glycosylase (OGG1)
NCBI Accession:
OGG1, ogg1.L, ogg1, ECU08_0770, CA_C2707, BBOV_I004290, Smp_074010.1, LOC9329243, Tb927.4.2480, Ogg1
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Catalog No. ABIN3563069
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

8-Oxoguanine DNA Glycosylase (OGG1)
Gene ID:
4968 (Human, OGG1)
OGG1, ogg1.L, ogg1, ECU08_0770, CA_C2707, BBOV_I004290, Smp_074010.1, LOC9329243, Tb927.4.2480, Ogg1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4085693
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

8-Oxoguanine DNA Glycosylase (OGG1)
Gene ID:
18294 (Mouse (Murine), OGG1)
OGG1, ogg1.L, ogg1, ECU08_0770, CA_C2707, BBOV_I004290, Smp_074010.1, LOC9329243, Tb927.4.2480, Ogg1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4003355
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

8-Oxoguanine DNA Glycosylase (OGG1)
Gene ID:
18294 (Mouse (Murine), OGG1)
OGG1, ogg1.L, ogg1, ECU08_0770, CA_C2707, BBOV_I004290, Smp_074010.1, LOC9329243, Tb927.4.2480, Ogg1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4003356
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

8-Oxoguanine DNA Glycosylase (OGG1)
Gene ID:
4968 (Human, OGG1)
OGG1, ogg1.L, ogg1, ECU08_0770, CA_C2707, BBOV_I004290, Smp_074010.1, LOC9329243, Tb927.4.2480, Ogg1
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5312152
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
Supplier: Log in to see

Protein Expression
8-Oxoguanine DNA Glycosylase (OGG1)
OGG1, ogg1.L, ogg1, ECU08_0770, CA_C2707, BBOV_I004290, Smp_074010.1, LOC9329243, Tb927.4.2480, Ogg1
Insert length:
1038 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
HA tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4478948
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

8-Oxoguanine DNA Glycosylase (OGG1)
OGG1, ogg1.L, ogg1, ECU08_0770, CA_C2707, BBOV_I004290, Smp_074010.1, LOC9329243, Tb927.4.2480, Ogg1
Insert length:
1038 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4622419
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

8-Oxoguanine DNA Glycosylase (OGG1)
OGG1, ogg1.L, ogg1, ECU08_0770, CA_C2707, BBOV_I004290, Smp_074010.1, LOC9329243, Tb927.4.2480, Ogg1
Insert length:
1038 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4707463
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

8-Oxoguanine DNA Glycosylase (OGG1)
OGG1, ogg1.L, ogg1, ECU08_0770, CA_C2707, BBOV_I004290, Smp_074010.1, LOC9329243, Tb927.4.2480, Ogg1
Insert length:
1038 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4770616
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Protein Expression
8-Oxoguanine DNA Glycosylase (OGG1)
OGG1, ogg1.L, ogg1, ECU08_0770, CA_C2707, BBOV_I004290, Smp_074010.1, LOC9329243, Tb927.4.2480, Ogg1
Insert length:
1038 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
His tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4440043
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

8-Oxoguanine DNA Glycosylase (OGG1)
OGG1, ogg1.L, ogg1, ECU08_0770, CA_C2707, BBOV_I004290, Smp_074010.1, LOC9329243, Tb927.4.2480, Ogg1
Insert length:
1038 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4836593
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Protein Expression
8-Oxoguanine DNA Glycosylase (OGG1)
Gene ID:
4968 (Human, OGG1)
OGG1, ogg1.L, ogg1, ECU08_0770, CA_C2707, BBOV_I004290, Smp_074010.1, LOC9329243, Tb927.4.2480, Ogg1
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3424933
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression
8-Oxoguanine DNA Glycosylase (OGG1)
Gene ID:
4968 (Human, OGG1)
OGG1, ogg1.L, ogg1, ECU08_0770, CA_C2707, BBOV_I004290, Smp_074010.1, LOC9329243, Tb927.4.2480, Ogg1
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3394233
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression
8-Oxoguanine DNA Glycosylase (OGG1)
Gene ID:
4968 (Human, OGG1)
OGG1, ogg1.L, ogg1, ECU08_0770, CA_C2707, BBOV_I004290, Smp_074010.1, LOC9329243, Tb927.4.2480, Ogg1
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3423942
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Protein Expression
8-Oxoguanine DNA Glycosylase (OGG1)
NCBI Accession:
Rat (Rattus)
OGG1, ogg1.L, ogg1, ECU08_0770, CA_C2707, BBOV_I004290, Smp_074010.1, LOC9329243, Tb927.4.2480, Ogg1
Insert length:
1038 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3333300
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
Supplier: Log in to see

Protein Expression
8-Oxoguanine DNA Glycosylase (OGG1)
NCBI Accession:
Mouse (Murine)
OGG1, ogg1.L, ogg1, ECU08_0770, CA_C2707, BBOV_I004290, Smp_074010.1, LOC9329243, Tb927.4.2480, Ogg1
Insert length:
1038 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3333299
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
  • <
  • 1

Synonyms and alternative names related to OGG1

  • 8-oxoguanine DNA glycosylase (OGG1)
  • 8-oxoguanine DNA glycosylase L homeolog (ogg1.L)
  • 8-oxoguanine DNA glycosylase (ogg1)
  • 8-oxoguanine-DNA glycosylase 1 (OGG1)
  • 8-oxoguanine DNA glycosylase (CA_C2707)
  • 8-oxoguanine DNA glycosylase (BBOV_I004290)
  • putative 8-oxoguanine DNA glycosylase (Smp_074010.1)
  • 8-oxoguanine DNA-glycosylase (ogg1)
  • N-glycosylase/DNA lyase OGG1 (LOC9329243)
  • 8-oxoguanine DNA glycosylase (Tb927.4.2480)
  • 8-oxoguanine DNA glycosylase (Ogg1)
  • 8-oxoguanine DNA-glycosylase 1 (Ogg1)
  • 8-oxoguanine-DNA glycosylase 1
  • 19.m02329
  • ATOGG1
  • DDBDRAFT_0184479
  • DDBDRAFT_0233024
  • DDB_0184479
  • DDB_0233024
  • F8K7.14
  • F8K7_14
  • HMMH
  • HOGG1
  • Mmh
  • MUTM
  • ogg1
  • OGG1
  • OGH1
  • Tb04.1H19.930
  • zgc:158858

Gene-IDs for different species

460152 Pan troglodytes
700481 Macaca mulatta
733253 Xenopus laevis
771001 Gallus gallus
791194 Danio rerio
838775 Arabidopsis thaliana
859629 Encephalitozoon cuniculi GB-M1
1118890 Clostridium acetobutylicum ATCC 824
4837452 Scheffersomyces stipitis CBS 6054
5477294 Babesia bovis T2Bo
8346251 Schistosoma mansoni
8628782 Dictyostelium discoideum AX4
9329243 Arabidopsis lyrata subsp. lyrata
100195518 Salmo salar
100380072 Xenopus (Silurana) tropicalis
100432840 Pongo abelii
3656775 Trypanosoma brucei brucei strain 927/4 GUTat10.1
4968 Homo sapiens
81528 Rattus norvegicus
484666 Canis lupus familiaris
520497 Bos taurus
18294 Mus musculus

Protein level used designations for OGG1

  • 8-oxoguanine DNA glycosylase
  • N-glycosylase/DNA lyase
  • 8-oxoguanine-DNA-glycosylase
  • DNA-formamidopyrimidine glycosylase
  • 8-oxoguanine-DNA glycosylase 1
  • 8-oxoguanine DNA-glycosylase 1
  • n-glycosylase/DNA lyase-like
  • 8-hydroxyguanine DNA glycosylase
  • AP lyase
  • DNA-apurinic or apyrimidinic site lyase
  • OGG1 type 1f
Other products related to OGG1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com