OGG1 (8-Oxoguanine DNA Glycosylase, OGG1)

Short Description: This gene encodes the enzyme responsible for the excision of 8-oxoguanine, a mutagenic base byproduct which occurs as a result of exposure to reactive oxygen. The action of this enzyme includes lyase activity for chain cleavage. Alternative splicing of the C-terminal region of this gene classifies splice variants into two major groups, type 1 and type 2, depending on the last exon of the sequence. Type 1 alternative splice variants end with exon 7 and type 2 end with exon 8. All variants share the N-terminal region in common, which contains a mitochondrial targeting signal that is essential for mitochondrial localization. Many alternative splice variants for this gene have been described, but the full-length nature for every variant has not been determined. [provided by RefSeq, Aug 2008].
More information related to gene OGG1.
Products related to OGG1 Gene:
159 Products
Type
  • 155
  • 3
  • 1
Species
  • 88
  • 30
  • 25
  • 14
  • 2
Application
  • 110
  • 24
  • 22
  • 16
  • 1
Fusion tag
  • 43
  • 33
  • 27
  • 11
  • 10
Vector Backbone
  • 16
  • 16
  • 16
  • 8
  • 8
Vector
  • 67
  • 56
  • 12
  • 9
  • 6
Insert
  • 75
  • 43
  • 21
  • 8
  • 6
Oligo-Type
  • 3
Resistance Gene
  • 60
  • 53
  • 40
  • 2
  • 2
Expression Type
  • 131
  • 65
  • 13
Selectable Marker
  • 49
  • 26
  • 13
  • 1
Promoter
  • 72
  • 31
  • 26
  • 14
  • 8
Format
  • 90
  • 28
  • 24
  • 16

Type:
ORF
Application:
Protein Expression
Gene:
8-Oxoguanine DNA Glycosylase (OGG1)
NCBI Accession:
NM_002542,NP_002533
Species:
Human
Synonyms:
OGG1, ogg1.L, ogg1, ECU08_0770, CA_C2707, BBOV_I004290, Smp_074010.1, LOC9329243, Tb927.4.2480, Ogg1
Insert length:
1038 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5391196
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Cloning
Gene:
8-Oxoguanine DNA Glycosylase (OGG1)
Gene ID:
4968 (Human, OGG1)
Synonyms:
OGG1, ogg1.L, ogg1, ECU08_0770, CA_C2707, BBOV_I004290, Smp_074010.1, LOC9329243, Tb927.4.2480, Ogg1
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4085694
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
8-Oxoguanine DNA Glycosylase (OGG1)
Gene ID:
18294 (Mouse (Murine), OGG1)
Synonyms:
OGG1, ogg1.L, ogg1, ECU08_0770, CA_C2707, BBOV_I004290, Smp_074010.1, LOC9329243, Tb927.4.2480, Ogg1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4003358
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
8-Oxoguanine DNA Glycosylase (OGG1)
Gene ID:
18294 (Mouse (Murine), OGG1)
Synonyms:
OGG1, ogg1.L, ogg1, ECU08_0770, CA_C2707, BBOV_I004290, Smp_074010.1, LOC9329243, Tb927.4.2480, Ogg1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4003357
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
8-Oxoguanine DNA Glycosylase (OGG1)
NCBI Accession:
XM_005547753
Species:
Cynomolgus
Synonyms:
OGG1, ogg1.L, ogg1, ECU08_0770, CA_C2707, BBOV_I004290, Smp_074010.1, LOC9329243, Tb927.4.2480, Ogg1
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3563069
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
cDNA
Application:
Cloning
Gene:
8-Oxoguanine DNA Glycosylase (OGG1)
Gene ID:
4968 (Human, OGG1)
Synonyms:
OGG1, ogg1.L, ogg1, ECU08_0770, CA_C2707, BBOV_I004290, Smp_074010.1, LOC9329243, Tb927.4.2480, Ogg1
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4085693
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
8-Oxoguanine DNA Glycosylase (OGG1)
Gene ID:
18294 (Mouse (Murine), OGG1)
Synonyms:
OGG1, ogg1.L, ogg1, ECU08_0770, CA_C2707, BBOV_I004290, Smp_074010.1, LOC9329243, Tb927.4.2480, Ogg1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4003355
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
8-Oxoguanine DNA Glycosylase (OGG1)
Gene ID:
18294 (Mouse (Murine), OGG1)
Synonyms:
OGG1, ogg1.L, ogg1, ECU08_0770, CA_C2707, BBOV_I004290, Smp_074010.1, LOC9329243, Tb927.4.2480, Ogg1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4003356
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
8-Oxoguanine DNA Glycosylase (OGG1)
Gene ID:
4968 (Human, OGG1)
Synonyms:
OGG1, ogg1.L, ogg1, ECU08_0770, CA_C2707, BBOV_I004290, Smp_074010.1, LOC9329243, Tb927.4.2480, Ogg1
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5312152
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
8-Oxoguanine DNA Glycosylase (OGG1)
Species:
Human
Synonyms:
OGG1, ogg1.L, ogg1, ECU08_0770, CA_C2707, BBOV_I004290, Smp_074010.1, LOC9329243, Tb927.4.2480, Ogg1
Insert length:
1038 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4478948
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
8-Oxoguanine DNA Glycosylase (OGG1)
Species:
Human
Synonyms:
OGG1, ogg1.L, ogg1, ECU08_0770, CA_C2707, BBOV_I004290, Smp_074010.1, LOC9329243, Tb927.4.2480, Ogg1
Insert length:
1038 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4622419
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
8-Oxoguanine DNA Glycosylase (OGG1)
Species:
Human
Synonyms:
OGG1, ogg1.L, ogg1, ECU08_0770, CA_C2707, BBOV_I004290, Smp_074010.1, LOC9329243, Tb927.4.2480, Ogg1
Insert length:
1038 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4707463
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
8-Oxoguanine DNA Glycosylase (OGG1)
Species:
Human
Synonyms:
OGG1, ogg1.L, ogg1, ECU08_0770, CA_C2707, BBOV_I004290, Smp_074010.1, LOC9329243, Tb927.4.2480, Ogg1
Insert length:
1038 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4770616
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
8-Oxoguanine DNA Glycosylase (OGG1)
Species:
Human
Synonyms:
OGG1, ogg1.L, ogg1, ECU08_0770, CA_C2707, BBOV_I004290, Smp_074010.1, LOC9329243, Tb927.4.2480, Ogg1
Insert length:
1038 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4440043
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
8-Oxoguanine DNA Glycosylase (OGG1)
Species:
Human
Synonyms:
OGG1, ogg1.L, ogg1, ECU08_0770, CA_C2707, BBOV_I004290, Smp_074010.1, LOC9329243, Tb927.4.2480, Ogg1
Insert length:
1038 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4836593
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
8-Oxoguanine DNA Glycosylase (OGG1)
Gene ID:
4968 (Human, OGG1)
Synonyms:
OGG1, ogg1.L, ogg1, ECU08_0770, CA_C2707, BBOV_I004290, Smp_074010.1, LOC9329243, Tb927.4.2480, Ogg1
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR221
Resistance Gene:
Kanamycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3424933
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
8-Oxoguanine DNA Glycosylase (OGG1)
Gene ID:
4968 (Human, OGG1)
Synonyms:
OGG1, ogg1.L, ogg1, ECU08_0770, CA_C2707, BBOV_I004290, Smp_074010.1, LOC9329243, Tb927.4.2480, Ogg1
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3394233
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
8-Oxoguanine DNA Glycosylase (OGG1)
Gene ID:
4968 (Human, OGG1)
Synonyms:
OGG1, ogg1.L, ogg1, ECU08_0770, CA_C2707, BBOV_I004290, Smp_074010.1, LOC9329243, Tb927.4.2480, Ogg1
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR221
Resistance Gene:
Kanamycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3423942
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
8-Oxoguanine DNA Glycosylase (OGG1)
NCBI Accession:
NM_030870,NP_110497
Species:
Rat (Rattus)
Synonyms:
OGG1, ogg1.L, ogg1, ECU08_0770, CA_C2707, BBOV_I004290, Smp_074010.1, LOC9329243, Tb927.4.2480, Ogg1
Insert length:
1038 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3333300
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
8-Oxoguanine DNA Glycosylase (OGG1)
NCBI Accession:
NM_010957,NP_035087
Species:
Mouse (Murine)
Synonyms:
OGG1, ogg1.L, ogg1, ECU08_0770, CA_C2707, BBOV_I004290, Smp_074010.1, LOC9329243, Tb927.4.2480, Ogg1
Insert length:
1038 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3333299
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
  • <
  • 1

Synonyms and alternative names related to OGG1

  • 8-oxoguanine DNA glycosylase (OGG1)
  • 8-oxoguanine DNA glycosylase L homeolog (ogg1.L)
  • 8-oxoguanine DNA glycosylase (ogg1)
  • 8-oxoguanine-DNA glycosylase 1 (OGG1)
  • 8-OXOGUANINE DNA GLYCOSYLASE (ECU08_0770)
  • 8-oxoguanine DNA glycosylase (CA_C2707)
  • 8-oxoguanine DNA glycosylase (BBOV_I004290)
  • putative 8-oxoguanine DNA glycosylase (Smp_074010.1)
  • 8-oxoguanine DNA-glycosylase (ogg1)
  • N-glycosylase/DNA lyase OGG1 (LOC9329243)
  • 8-oxoguanine DNA glycosylase (Tb927.4.2480)
  • 8-oxoguanine DNA glycosylase (Ogg1)
  • 8-oxoguanine DNA-glycosylase 1 (Ogg1)
  • 8-oxoguanine-DNA glycosylase 1
  • 19.m02329
  • ARABIDOPSIS 8-OXOGUANINE-DNA GLYCOSYLASE 1
  • ATOGG1
  • DDBDRAFT_0184479
  • DDBDRAFT_0233024
  • DDB_0184479
  • DDB_0233024
  • F8K7.14
  • F8K7_14
  • HMMH
  • HOGG1
  • Mmh
  • MUTM
  • ogg1
  • OGG1
  • OGH1
  • Tb04.1H19.930
  • zgc:158858

Gene-IDs for different species

GENE IDSPECIES
460152 Pan troglodytes
700481 Macaca mulatta
733253 Xenopus laevis
771001 Gallus gallus
791194 Danio rerio
838775 Arabidopsis thaliana
859629 Encephalitozoon cuniculi GB-M1
1118890 Clostridium acetobutylicum ATCC 824
4837452 Scheffersomyces stipitis CBS 6054
5477294 Babesia bovis T2Bo
8346251 Schistosoma mansoni
8628782 Dictyostelium discoideum AX4
9329243 Arabidopsis lyrata subsp. lyrata
100195518 Salmo salar
100380072 Xenopus (Silurana) tropicalis
100432840 Pongo abelii
3656775 Trypanosoma brucei brucei strain 927/4 GUTat10.1
4968 Homo sapiens
81528 Rattus norvegicus
484666 Canis lupus familiaris
520497 Bos taurus
18294 Mus musculus

Protein level used designations for OGG1

  • 8-oxoguanine DNA glycosylase
  • N-glycosylase/DNA lyase
  • 8-OXOGUANINE DNA GLYCOSYLASE
  • 8-oxoguanine-DNA-glycosylase
  • DNA-formamidopyrimidine glycosylase
  • 8-oxoguanine-DNA glycosylase 1
  • 8-oxoguanine DNA-glycosylase 1
  • n-glycosylase/DNA lyase-like
  • 8-hydroxyguanine DNA glycosylase
  • AP lyase
  • DNA-apurinic or apyrimidinic site lyase
  • OGG1 type 1f
Other products related to OGG1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com