OMA1 (OMA1 Zinc Metallopeptidase Homolog (S. Cerevisiae), OMA1)

Short Description: Metalloprotease that is part of the quality control system in the inner membrane of mitochondria. Following stress conditions that induce loss of mitochondrial membrane potential, mediates cleavage of OPA1 at S1 position, leading to OPA1 inactivation and negative regulation of mitochondrial fusion. Its role in mitochondrial quality control is essential for regulating lipid metabolism as well as to maintain body temperature and energy expenditure under cold-stress conditions (By similarity).
More information related to gene OMA1.
Products related to OMA1 Gene:
97 Products
Data Quality
  • 2
Type
  • 93
  • 4
Species
  • 40
  • 28
  • 27
  • 2
Application
  • 52
  • 25
  • 22
  • 16
Fusion tag
  • 34
  • 16
  • 10
  • 9
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 36
  • 30
  • 12
  • 9
  • 3
Insert
  • 33
  • 23
  • 21
  • 8
  • 6
Oligo-Type
  • 4
Resistance Gene
  • 36
  • 33
  • 18
  • 6
  • 2
Expression Type
  • 90
  • 51
Selectable Marker
  • 26
  • 25
  • 1
Promoter
  • 31
  • 31
  • 13
  • 12
  • 8
Format
  • 35
  • 27
  • 22
  • 13

Type:
ORF
Application:
Cloning
Gene:
OMA1 Zinc Metallopeptidase Homolog (S. Cerevisiae) (OMA1)
Species:
Human
Synonyms:
OMA1, Oma1, si:ch73-215a11.1
Insert length:
1575 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5767179
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
OMA1 Zinc Metallopeptidase Homolog (S. Cerevisiae) (OMA1)
Gene ID:
506223 (Cow (Bovine), OMA1)
Synonyms:
OMA1, Oma1, si:ch73-215a11.1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3854783
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
OMA1 Zinc Metallopeptidase Homolog (S. Cerevisiae) (OMA1)
Gene ID:
67013 (Mouse (Murine), OMA1)
Synonyms:
OMA1, Oma1, si:ch73-215a11.1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3820824
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
OMA1 Zinc Metallopeptidase Homolog (S. Cerevisiae) (OMA1)
Gene ID:
115209 (Human, OMA1)
Synonyms:
OMA1, Oma1, si:ch73-215a11.1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3831376
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
OMA1 Zinc Metallopeptidase Homolog (S. Cerevisiae) (OMA1)
Gene ID:
506223 (Cow (Bovine), OMA1)
Synonyms:
OMA1, Oma1, si:ch73-215a11.1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3854781
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
OMA1 Zinc Metallopeptidase Homolog (S. Cerevisiae) (OMA1)
Gene ID:
67013 (Mouse (Murine), OMA1)
Synonyms:
OMA1, Oma1, si:ch73-215a11.1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3820825
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
OMA1 Zinc Metallopeptidase Homolog (S. Cerevisiae) (OMA1)
Gene ID:
115209 (Human, OMA1)
Synonyms:
OMA1, Oma1, si:ch73-215a11.1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3831375
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
OMA1 Zinc Metallopeptidase Homolog (S. Cerevisiae) (OMA1)
Gene ID:
115209 (Human, OMA1)
Synonyms:
OMA1, Oma1, si:ch73-215a11.1
Insert length:
1575 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5318464
$189.37
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
OMA1 Zinc Metallopeptidase Homolog (S. Cerevisiae) (OMA1)
Species:
Human
Synonyms:
OMA1, Oma1, si:ch73-215a11.1
Insert length:
1575 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4440058
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
OMA1 Zinc Metallopeptidase Homolog (S. Cerevisiae) (OMA1)
Species:
Human
Synonyms:
OMA1, Oma1, si:ch73-215a11.1
Insert length:
1575 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4707484
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
OMA1 Zinc Metallopeptidase Homolog (S. Cerevisiae) (OMA1)
Species:
Human
Synonyms:
OMA1, Oma1, si:ch73-215a11.1
Insert length:
1575 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4622434
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
OMA1 Zinc Metallopeptidase Homolog (S. Cerevisiae) (OMA1)
Species:
Human
Synonyms:
OMA1, Oma1, si:ch73-215a11.1
Insert length:
1575 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4478963
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
OMA1 Zinc Metallopeptidase Homolog (S. Cerevisiae) (OMA1)
Species:
Human
Synonyms:
OMA1, Oma1, si:ch73-215a11.1
Insert length:
1575 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4836614
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
OMA1 Zinc Metallopeptidase Homolog (S. Cerevisiae) (OMA1)
Species:
Human
Synonyms:
OMA1, Oma1, si:ch73-215a11.1
Insert length:
1575 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4770631
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
OMA1 Zinc Metallopeptidase Homolog (S. Cerevisiae) (OMA1)
Gene ID:
115209 (Human, OMA1)
Synonyms:
OMA1, Oma1, si:ch73-215a11.1
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3430280
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
OMA1 Zinc Metallopeptidase Homolog (S. Cerevisiae) (OMA1)
Gene ID:
115209 (Human, OMA1)
Synonyms:
OMA1, Oma1, si:ch73-215a11.1
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3410204
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
OMA1 Zinc Metallopeptidase Homolog (S. Cerevisiae) (OMA1)
NCBI Accession:
NM_145243,NP_660286
Species:
Human
Synonyms:
OMA1, Oma1, si:ch73-215a11.1
Insert length:
1575 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5493591
$420.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
OMA1 Zinc Metallopeptidase Homolog (S. Cerevisiae) (OMA1)
NCBI Accession:
NM_145243
Species:
Human
Synonyms:
OMA1, Oma1, si:ch73-215a11.1
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of OMA1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5171348
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
OMA1 Zinc Metallopeptidase Homolog (S. Cerevisiae) (OMA1)
NCBI Accession:
NM_025909
Species:
Mouse (Murine)
Synonyms:
OMA1, Oma1, si:ch73-215a11.1
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Oma1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5171350
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
OMA1 Zinc Metallopeptidase Homolog (S. Cerevisiae) (OMA1)
NCBI Accession:
NM_001106669
Species:
Rat (Rattus)
Synonyms:
OMA1, Oma1, si:ch73-215a11.1
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Oma1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5171352
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available
  • <
  • 1

Synonyms and alternative names related to OMA1

  • OMA1 zinc metallopeptidase (OMA1)
  • OMA1 zinc metallopeptidase (Oma1)
  • si:ch73-215a11.1 (si:ch73-215a11.1)
  • 2010001O09Rik
  • DAB1
  • MPRP-1
  • oma1
  • peptidase
  • RGD1304821
  • YKR087C
  • ZMPOMA1

Gene-IDs for different species

GENE IDSPECIES
115209 Homo sapiens
298282 Rattus norvegicus
67013 Mus musculus
506223 Bos taurus
100730704 Cavia porcellus
100331186 Danio rerio
100338330 Oryctolagus cuniculus
489569 Canis lupus familiaris
100067642 Equus caballus

Protein level used designations for OMA1

  • OMA1 homolog, zinc metallopeptidase
  • OMA1 zinc metallopeptidase homolog
  • metalloendopeptidase OMA1, mitochondrial
  • metalloprotease related protein 1
  • metalloprotease-related protein 1
  • overlapping activity with M-AAA protease
  • overlapping with the m-AAA protease 1 homolog
  • zinc metallopeptidase OMA1
  • Metalloendopeptidase OMA1, mitochondrial
  • OMA1 zinc metallopeptidase
  • Overlapping with the m-AAA protease 1 homolog
  • Metalloendopeptidase OMA1, mitochondrial-like protein
  • metalloendopeptidase OMA1 mitochondrial-like protein
Other products related to OMA1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com