OSGEPL1 (O-Sialoglycoprotein Endopeptidase-Like 1, OSGEPL1)

Short Description: Required for the formation of a threonylcarbamoyl group on adenosine at position 37 (t(6)A37) in tRNAs that read codons beginning with adenine (By similarity).
More information related to gene OSGEPL1.
Products related to OSGEPL1 Gene:
111 Products
Type
  • 106
  • 5
Species
  • 43
  • 38
  • 28
  • 2
Application
  • 65
  • 25
  • 22
  • 16
  • 1
Fusion tag
  • 37
  • 16
  • 11
  • 10
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 44
  • 35
  • 12
  • 9
  • 3
Insert
  • 37
  • 32
  • 21
  • 8
  • 6
Oligo-Type
  • 4
  • 1
Resistance Gene
  • 48
  • 37
  • 20
  • 2
  • 1
Expression Type
  • 87
  • 49
  • 13
Selectable Marker
  • 26
  • 25
  • 13
Promoter
  • 31
  • 31
  • 23
  • 14
  • 8
Format
  • 51
  • 24
  • 22
  • 14

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
O-Sialoglycoprotein Endopeptidase-Like 1 (OSGEPL1)
Gene ID:
72085 (Mouse (Murine), OSGEPL1)
Synonyms:
OSGEPL1, Osgepl1, osgepl1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3824361
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
O-Sialoglycoprotein Endopeptidase-Like 1 (OSGEPL1)
Gene ID:
64172 (Human, OSGEPL1)
Synonyms:
OSGEPL1, Osgepl1, osgepl1
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4092521
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
O-Sialoglycoprotein Endopeptidase-Like 1 (OSGEPL1)
Gene ID:
314548 (Rat (Rattus), OSGEPL1)
Synonyms:
OSGEPL1, Osgepl1, osgepl1
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4053539
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
O-Sialoglycoprotein Endopeptidase-Like 1 (OSGEPL1)
NCBI Accession:
NM_028091
Species:
Mouse (Murine)
Synonyms:
OSGEPL1, Osgepl1, osgepl1
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3563139
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Application:
Quantitative real-time PCR
Gene:
O-Sialoglycoprotein Endopeptidase-Like 1
Species:
Mouse (Murine)
Synonyms:
Qri7, 2610001M19Rik, AA416452, si:dz72b14.6
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3195084
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
O-Sialoglycoprotein Endopeptidase-Like 1 (OSGEPL1)
Gene ID:
314548 (Rat (Rattus), OSGEPL1)
Synonyms:
OSGEPL1, Osgepl1, osgepl1
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3462415
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
O-Sialoglycoprotein Endopeptidase-Like 1 (OSGEPL1)
Gene ID:
72085 (Mouse (Murine), OSGEPL1)
Synonyms:
OSGEPL1, Osgepl1, osgepl1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3824362
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
O-Sialoglycoprotein Endopeptidase-Like 1 (OSGEPL1)
Gene ID:
64172 (Human, OSGEPL1)
Synonyms:
OSGEPL1, Osgepl1, osgepl1
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4092520
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
O-Sialoglycoprotein Endopeptidase-Like 1 (OSGEPL1)
Gene ID:
64172 (Human, OSGEPL1)
Synonyms:
OSGEPL1, Osgepl1, osgepl1
Insert length:
1245 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5314712
$189.37
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Cloning
Gene:
O-Sialoglycoprotein Endopeptidase-Like 1 (OSGEPL1)
Species:
Human
Synonyms:
OSGEPL1, Osgepl1, osgepl1
Insert length:
1245 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4622477
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
O-Sialoglycoprotein Endopeptidase-Like 1 (OSGEPL1)
Species:
Human
Synonyms:
OSGEPL1, Osgepl1, osgepl1
Insert length:
1245 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4440101
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
O-Sialoglycoprotein Endopeptidase-Like 1 (OSGEPL1)
Species:
Human
Synonyms:
OSGEPL1, Osgepl1, osgepl1
Insert length:
1245 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4479006
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
O-Sialoglycoprotein Endopeptidase-Like 1 (OSGEPL1)
Species:
Human
Synonyms:
OSGEPL1, Osgepl1, osgepl1
Insert length:
1245 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4770674
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
O-Sialoglycoprotein Endopeptidase-Like 1 (OSGEPL1)
Species:
Human
Synonyms:
OSGEPL1, Osgepl1, osgepl1
Insert length:
1245 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4707758
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
O-Sialoglycoprotein Endopeptidase-Like 1 (OSGEPL1)
Species:
Human
Synonyms:
OSGEPL1, Osgepl1, osgepl1
Insert length:
1245 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4836888
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
O-Sialoglycoprotein Endopeptidase-Like 1 (OSGEPL1)
Gene ID:
64172 (Human, OSGEPL1)
Synonyms:
OSGEPL1, Osgepl1, osgepl1
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR221
Resistance Gene:
Kanamycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3424126
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
O-Sialoglycoprotein Endopeptidase-Like 1 (OSGEPL1)
Gene ID:
64172 (Human, OSGEPL1)
Synonyms:
OSGEPL1, Osgepl1, osgepl1
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR221
Resistance Gene:
Kanamycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3420884
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
O-Sialoglycoprotein Endopeptidase-Like 1 (OSGEPL1)
Species:
Human
Synonyms:
OSGEPL1, Osgepl1, osgepl1
Insert length:
1917 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3391305
$310.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
O-Sialoglycoprotein Endopeptidase-Like 1 (OSGEPL1)
NCBI Accession:
NM_001285839,NP_001272768
Species:
Mouse (Murine)
Synonyms:
OSGEPL1, Osgepl1, osgepl1
Insert length:
1245 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3363077
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
O-Sialoglycoprotein Endopeptidase-Like 1 (OSGEPL1)
NCBI Accession:
NM_001024787,NP_001019958
Species:
Rat (Rattus)
Synonyms:
OSGEPL1, Osgepl1, osgepl1
Insert length:
1245 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3363078
$420.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days
  • <
  • 1

Synonyms and alternative names related to OSGEPL1

  • O-sialoglycoprotein endopeptidase like 1 (OSGEPL1)
  • O-sialoglycoprotein endopeptidase-like 1 (Osgepl1)
  • O-sialoglycoprotein endopeptidase-like 1 (osgepl1)
  • 2610001M19Rik
  • AA416452
  • Qri7
  • si:dz72b14.6

Gene-IDs for different species

GENE IDSPECIES
64172 Homo sapiens
72085 Mus musculus
314548 Rattus norvegicus
368635 Danio rerio

Protein level used designations for OSGEPL1

  • O-sialoglycoprotein endopeptidase like 1
  • O-sialoglycoprotein endopeptidase-like protein 1
  • probable O-sialoglycoprotein endopeptidase 2
  • probable tRNA threonylcarbamoyladenosine biosynthesis protein OSGEPL1
  • putative sialoglycoprotease type 2
  • t(6)A37 threonylcarbamoyladenosine biosynthesis protein OSGEPL1
  • probable tRNA threonylcarbamoyladenosine biosynthesis protein Osgepl1
  • t(6)A37 threonylcarbamoyladenosine biosynthesis protein Osgepl1
  • glycoprotease
  • probable tRNA threonylcarbamoyladenosine biosynthesis protein osgepl1
  • t(6)A37 threonylcarbamoyladenosine biosynthesis protein osgepl1
Other products related to OSGEPL1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com