Paxillin (Paxillin, PXN)

Short Description: This gene encodes a cytoskeletal protein involved in actin-membrane attachment at sites of cell adhesion to the extracellular matrix (focal adhesion). Alternatively spliced transcript variants encoding different isoforms have been described for this gene. These isoforms exhibit different expression pattern, and have different biochemical, as well as physiological properties (PMID:9054445). [provided by RefSeq, Aug 2011].
More information related to gene Paxillin.
Products related to Paxillin Gene:
153 Products
Data Quality
  • 1
Type
  • 148
  • 5
Species
  • 68
  • 52
  • 29
  • 2
  • 2
Application
  • 97
  • 32
  • 25
  • 16
  • 1
Fusion tag
  • 46
  • 21
  • 16
  • 15
  • 8
Vector Backbone
  • 10
  • 8
  • 8
  • 6
  • 6
Vector
  • 73
  • 39
  • 16
  • 9
  • 9
Insert
  • 60
  • 51
  • 21
  • 8
  • 6
Oligo-Type
  • 4
  • 1
Resistance Gene
  • 72
  • 49
  • 22
  • 5
  • 2
Expression Type
  • 115
  • 59
  • 26
  • 2
Selectable Marker
  • 42
  • 26
  • 26
Promoter
  • 48
  • 41
  • 31
  • 16
  • 8
Format
  • 80
  • 36
  • 22
  • 15

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Paxillin (PXN)
Gene ID:
397826 (Xenopus laevis, PXN)
Synonyms:
PXN, Pxn, Pax, pxn.S, pxna, LOC696336, pxn
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3882444
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Paxillin (PXN)
Gene ID:
5829 (Human, PXN)
Synonyms:
PXN, Pxn, Pax, pxn.S, pxna, LOC696336, pxn
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4000207
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Paxillin (PXN)
Gene ID:
5829 (Human, PXN)
Synonyms:
PXN, Pxn, Pax, pxn.S, pxna, LOC696336, pxn
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4000208
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Paxillin (PXN)
Gene ID:
360820 (Rat (Rattus), PXN)
Synonyms:
PXN, Pxn, Pax, pxn.S, pxna, LOC696336, pxn
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4054711
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Paxillin (PXN)
Gene ID:
100216044 (Xenopus tropicalis, PXN)
Synonyms:
PXN, Pxn, Pax, pxn.S, pxna, LOC696336, pxn
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS108
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4032899
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Paxillin (PXN)
NCBI Accession:
NM_002859
Species:
Human
Synonyms:
PXN, Pxn, Pax, pxn.S, pxna, LOC696336, pxn
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3564023
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Paxillin (PXN)
NCBI Accession:
NM_133915
Species:
Mouse (Murine)
Synonyms:
PXN, Pxn, Pax, pxn.S, pxna, LOC696336, pxn
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3564024
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Paxillin
Species:
Human
Synonyms:
AW108311, AW123232, Pax, CG18061, CG18576, CG31794, CT40481, CT42454, DPaxillin, DPxn, DPxn37, Dmel\\CG31794, Dpax, DpaxA, PDLP, dPax, pax, wu:fw71f12, PXN, LOC100220858
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3188512
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Paxillin (PXN)
Gene ID:
397826 (Xenopus laevis, PXN)
Synonyms:
PXN, Pxn, Pax, pxn.S, pxna, LOC696336, pxn
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3882445
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Paxillin (PXN)
Gene ID:
5829 (Human, PXN)
Synonyms:
PXN, Pxn, Pax, pxn.S, pxna, LOC696336, pxn
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4000209
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Paxillin (PXN)
Gene ID:
5829 (Human, PXN)
Synonyms:
PXN, Pxn, Pax, pxn.S, pxna, LOC696336, pxn
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4000206
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Paxillin (PXN)
Gene ID:
360820 (Rat (Rattus), PXN)
Synonyms:
PXN, Pxn, Pax, pxn.S, pxna, LOC696336, pxn
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4054712
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Paxillin (PXN)
Gene ID:
100216044 (Xenopus tropicalis, PXN)
Synonyms:
PXN, Pxn, Pax, pxn.S, pxna, LOC696336, pxn
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS108
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4032900
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Paxillin (PXN)
Gene ID:
19303 (Mouse (Murine), PXN)
Synonyms:
PXN, Pxn, Pax, pxn.S, pxna, LOC696336, pxn
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR223-1
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3433451
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Paxillin (PXN)
NCBI Accession:
NM_025157,NP_079433
Species:
Human
Synonyms:
PXN, Pxn, Pax, pxn.S, pxna, LOC696336, pxn
Insert length:
1275 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5360879
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Paxillin (PXN)
NCBI Accession:
NM_001080855,NP_001074324
Species:
Human
Synonyms:
PXN, Pxn, Pax, pxn.S, pxna, LOC696336, pxn
Insert length:
1776 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5360880
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Application:
RNA Interference
Gene:
Paxillin
Species:
Human
Synonyms:
AW108311, AW123232, Pax, CG18061, CG18576, CG31794, CT40481, CT42454, DPaxillin, DPxn, DPxn37, Dmel\\CG31794, Dpax, DpaxA, PDLP, dPax, pax, wu:fw71f12, PXN, LOC100220858
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • PXN (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Publications
  • Du, Wang, Zhang, Liu, Zhu, Liu: "Paxillin is positively correlated with the clinicopathological factors of colorectal cancer, and knockdown of Paxillin improves sensitivity to cetuximab in colorectal cancer cells." in: Oncology reports, Vol. 35, Issue 1, pp. 409-17, 2015 (Pubmed)
Catalog No. ABIN3343702
$420.00
1 kit
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Application:
RNA Interference
Gene:
Paxillin
Species:
Mouse (Murine)
Synonyms:
AW108311, AW123232, Pax, CG18061, CG18576, CG31794, CT40481, CT42454, DPaxillin, DPxn, DPxn37, Dmel\\CG31794, Dpax, DpaxA, PDLP, dPax, pax, wu:fw71f12, PXN, LOC100220858
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Pxn (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3264865
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Paxillin
Species:
Rat (Rattus)
Synonyms:
AW108311, AW123232, Pax, CG18061, CG18576, CG31794, CT40481, CT42454, DPaxillin, DPxn, DPxn37, Dmel\\CG31794, Dpax, DpaxA, PDLP, dPax, pax, wu:fw71f12, PXN, LOC100220858
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Pxn (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3315558
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Paxillin (PXN)
NCBI Accession:
NM_002859
Species:
Human
Synonyms:
PXN, Pxn, Pax, pxn.S, pxna, LOC696336, pxn
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of PXN
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5095408
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
  • <
  • 1

Synonyms and alternative names related to Paxillin

  • paxillin (PXN)
  • paxillin (Pxn)
  • Paxillin (Pax)
  • paxillin S homeolog (pxn.S)
  • paxillin a (pxna)
  • paxillin (LOC696336)
  • paxillin (pxn)
  • AW108311
  • AW123232
  • CG18061
  • CG18576
  • CG31794
  • CT40481
  • CT42454
  • Dmel\\CG31794
  • dPax
  • Dpax
  • DpaxA
  • DPaxillin
  • DPxn
  • DPxn37
  • LOC100220858
  • Pax
  • pax
  • PDLP
  • PXN
  • wu:fw71f12

Gene-IDs for different species

GENE IDSPECIES
5829 Homo sapiens
19303 Mus musculus
35215 Drosophila melanogaster
360820 Rattus norvegicus
395832 Gallus gallus
397826 Xenopus laevis
399546 Danio rerio
452303 Pan troglodytes
486299 Canis lupus familiaris
517456 Bos taurus
696336 Macaca mulatta
100053811 Equus caballus
100126846 Sus scrofa
100173313 Pongo abelii
100216044 Xenopus (Silurana) tropicalis
100220858 Taeniopygia guttata
100474505 Ailuropoda melanoleuca
100732427 Cavia porcellus
100353305 Oryctolagus cuniculus
101111491 Ovis aries musimon

Protein level used designations for Paxillin

  • CG31794-PA
  • CG31794-PB
  • CG31794-PC
  • CG31794-PD
  • CG31794-PF
  • CG31794-PG
  • CG31794-PH
  • CG31794-PJ
  • CG31794-PK
  • D-Paxillin
  • Pax-PA
  • Pax-PB
  • Pax-PC
  • Pax-PD
  • Pax-PF
  • Pax-PG
  • Pax-PH
  • Pax-PJ
  • Pax-PK
  • Paxillin-derived LIM-only protein
  • paxillin
  • myocardial ischemic preconditioning associated protein 7
Other products related to Paxillin such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com