PBLD1 (Phenazine Biosynthesis-Like Protein Domain Containing 1, PBLD1)

Short Description: human homolog may act as a hydroxylase [RGD, Feb 2006].
More information related to gene PBLD1.
Products related to PBLD1 Gene:
120 Products
Type
  • 117
  • 3
Species
  • 46
  • 45
  • 27
  • 2
Application
  • 77
  • 25
  • 22
  • 16
Fusion tag
  • 36
  • 21
  • 15
  • 11
  • 6
Vector Backbone
  • 10
  • 10
  • 6
  • 6
  • 6
Vector
  • 48
  • 42
  • 12
  • 9
  • 4
Insert
  • 46
  • 36
  • 19
  • 8
  • 6
Oligo-Type
  • 3
Resistance Gene
  • 47
  • 39
  • 26
  • 5
  • 2
Expression Type
  • 101
  • 51
  • 13
Selectable Marker
  • 28
  • 24
  • 13
  • 1
Promoter
  • 42
  • 31
  • 27
  • 12
  • 8
Format
  • 55
  • 27
  • 25
  • 13

Type:
ORF
Application:
Cloning
Gene:
Phenazine Biosynthesis-Like Protein Domain Containing 1 (PBLD1)
Species:
Human
Synonyms:
PBLD, Pbld1
Insert length:
867 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5763761
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Phenazine Biosynthesis-Like Protein Domain Containing 1 (PBLD1)
Gene ID:
64081 (Human, PBLD1)
Synonyms:
PBLD, Pbld1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3818961
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Phenazine Biosynthesis-Like Protein Domain Containing 1 (PBLD1)
Gene ID:
68371 (Mouse (Murine), PBLD1)
Synonyms:
PBLD, Pbld1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3822399
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Phenazine Biosynthesis-Like Protein Domain Containing 1 (PBLD1)
Gene ID:
504417 (Cow (Bovine), PBLD1)
Synonyms:
PBLD, Pbld1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3853904
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Phenazine Biosynthesis-Like Protein Domain Containing 1 (PBLD1)
Gene ID:
171564 (Rat (Rattus), PBLD1)
Synonyms:
PBLD, Pbld1
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4048398
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Phenazine Biosynthesis-Like Protein Domain Containing 1 (PBLD1)
NCBI Accession:
NM_026701
Species:
Mouse (Murine)
Synonyms:
PBLD, Pbld1
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3563231
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Phenazine Biosynthesis-Like Protein Domain Containing 1 (PBLD1)
Gene ID:
64081 (Human, PBLD1)
Synonyms:
PBLD, Pbld1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3818962
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Phenazine Biosynthesis-Like Protein Domain Containing 1 (PBLD1)
Gene ID:
68371 (Mouse (Murine), PBLD1)
Synonyms:
PBLD, Pbld1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3822400
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Phenazine Biosynthesis-Like Protein Domain Containing 1 (PBLD1)
Gene ID:
504417 (Cow (Bovine), PBLD1)
Synonyms:
PBLD, Pbld1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3853905
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Phenazine Biosynthesis-Like Protein Domain Containing 1 (PBLD1)
Gene ID:
171564 (Rat (Rattus), PBLD1)
Synonyms:
PBLD, Pbld1
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4048399
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Phenazine Biosynthesis-Like Protein Domain Containing 1 (PBLD1)
Gene ID:
64081 (Human, PBLD1)
Synonyms:
PBLD, Pbld1
Insert length:
867 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5316076
$189.37
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Phenazine Biosynthesis-Like Protein Domain Containing 1 (PBLD1)
Species:
Human
Synonyms:
PBLD, Pbld1
Insert length:
867 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4440230
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Phenazine Biosynthesis-Like Protein Domain Containing 1 (PBLD1)
Species:
Human
Synonyms:
PBLD, Pbld1
Insert length:
867 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4479135
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Phenazine Biosynthesis-Like Protein Domain Containing 1 (PBLD1)
Species:
Human
Synonyms:
PBLD, Pbld1
Insert length:
867 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4622606
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Phenazine Biosynthesis-Like Protein Domain Containing 1 (PBLD1)
Species:
Human
Synonyms:
PBLD, Pbld1
Insert length:
867 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4707964
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Phenazine Biosynthesis-Like Protein Domain Containing 1 (PBLD1)
Species:
Human
Synonyms:
PBLD, Pbld1
Insert length:
867 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4770803
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Phenazine Biosynthesis-Like Protein Domain Containing 1 (PBLD1)
Species:
Human
Synonyms:
PBLD, Pbld1
Insert length:
867 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4837094
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Phenazine Biosynthesis-Like Protein Domain Containing 1 (PBLD1)
Gene ID:
64081 (Human, PBLD1)
Synonyms:
PBLD, Pbld1
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3409860
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Phenazine Biosynthesis-Like Protein Domain Containing 1 (PBLD1)
NCBI Accession:
NM_138530,NP_612539
Species:
Rat (Rattus)
Synonyms:
PBLD, Pbld1
Insert length:
867 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3363535
$420.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Phenazine Biosynthesis-Like Protein Domain Containing 1 (PBLD1)
NCBI Accession:
NM_001033083
Species:
Human
Synonyms:
PBLD, Pbld1
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of PBLD
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5163950
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available
  • <
  • 1

Synonyms and alternative names related to PBLD1

  • phenazine biosynthesis like protein domain containing (PBLD)
  • phenazine biosynthesis-like protein domain containing 1 (Pbld1)
  • 0610038K03Rik
  • MAWBP
  • Mawbp
  • MAWDBP
  • Pbld

Gene-IDs for different species

GENE IDSPECIES
64081 Homo sapiens
68371 Mus musculus
171564 Rattus norvegicus
504417 Bos taurus
100171830 Pongo abelii

Protein level used designations for PBLD1

  • MAWD-binding protein
  • phenazine biosynthesis-like domain-containing protein
  • MAWD binding protein homolog 1
  • phenazine biosynthesis-like domain-containing protein 1
  • MAWD binding protein
  • sphenazine biosynthesis-like protein domain containing
Other products related to PBLD1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com