PEA15 (phosphoprotein Enriched in Astrocytes 15, PEA15)

Short Description: This gene encodes a death effector domain-containing protein, which is a major phosphoprotein in astrocytes, and an endogenous substrate for protein kinase C. Studies using knockout mice suggest that this protein may protect astrocytes from TNF-induced apoptosis. This protein is also overexpressed in type 2 diabetes mellitus, where it may contribute to insulin resistance in glucose uptake. [provided by RefSeq, Sep 2011].
More information related to gene PEA15.
Products related to PEA15 Gene:
101 Products
Data Quality
  • 1
Type
  • 98
  • 3
Species
  • 89
  • 5
  • 2
  • 2
  • 2
Application
  • 63
  • 31
  • 11
  • 7
  • 1
Fusion tag
  • 39
  • 11
  • 9
  • 8
  • 5
Vector Backbone
  • 8
  • 6
  • 4
  • 4
  • 3
Vector
  • 50
  • 16
  • 12
  • 9
  • 8
Insert
  • 42
  • 40
  • 9
  • 3
  • 2
Oligo-Type
  • 2
  • 1
Resistance Gene
  • 51
  • 28
  • 10
  • 9
  • 2
Expression Type
  • 71
  • 32
  • 13
Selectable Marker
  • 25
  • 13
  • 10
  • 1
Promoter
  • 29
  • 28
  • 14
  • 13
  • 4
Format
  • 43
  • 27
  • 21
  • 10

Type:
ORF
Application:
Cloning
Gene:
phosphoprotein Enriched in Astrocytes 15 (PEA15)
Species:
Human
Synonyms:
PEA15, Pea15, pea15.L, pea15
Insert length:
393 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5755979
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Cloning
Gene:
phosphoprotein Enriched in Astrocytes 15 (PEA15)
Species:
Human
Synonyms:
PEA15, Pea15, pea15.L, pea15
Insert length:
393 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5755980
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Cloning
Gene:
phosphoprotein Enriched in Astrocytes 15 (PEA15)
Species:
Human
Synonyms:
PEA15, Pea15, pea15.L, pea15
Insert length:
225 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5755981
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
phosphoprotein Enriched in Astrocytes 15 (PEA15)
NCBI Accession:
NM_003768,NP_003759
Species:
Human
Synonyms:
PEA15, Pea15, pea15.L, pea15
Insert length:
393 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5452135
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
phosphoprotein Enriched in Astrocytes 15 (PEA15)
Gene ID:
8682 (Human, PEA15)
Synonyms:
PEA15, Pea15, pea15.L, pea15
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3465639
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
phosphoprotein Enriched in Astrocytes 15 (PEA15)
Gene ID:
100145359 (Xenopus tropicalis, PEA15)
Synonyms:
PEA15, Pea15, pea15.L, pea15
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3873783
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
phosphoprotein Enriched in Astrocytes 15 (PEA15)
Gene ID:
8682 (Human, PEA15)
Synonyms:
PEA15, Pea15, pea15.L, pea15
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4211731
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
phosphoprotein Enriched in Astrocytes 15 (PEA15)
Gene ID:
8682 (Human, PEA15)
Synonyms:
PEA15, Pea15, pea15.L, pea15
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4087862
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
phosphoprotein Enriched in Astrocytes 15 (PEA15)
Gene ID:
510586 (Cow (Bovine), PEA15)
Synonyms:
PEA15, Pea15, pea15.L, pea15
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4062144
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
phosphoprotein Enriched in Astrocytes 15 (PEA15)
Gene ID:
734852 (Xenopus laevis, PEA15)
Synonyms:
PEA15, Pea15, pea15.L, pea15
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4068502
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
phosphoprotein Enriched in Astrocytes 15 (PEA15)
NCBI Accession:
NM_001013231
Species:
Rat (Rattus)
Synonyms:
PEA15, Pea15, pea15.L, pea15
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3563341
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
phosphoprotein Enriched in Astrocytes 15
Species:
Human
Synonyms:
HMAT1, HUMMAT1H, MAT1, MAT1H, PEA-15, PED, Pea15a, PEA15, DKFZp459O1410
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3189492
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
phosphoprotein Enriched in Astrocytes 15 (PEA15)
Gene ID:
8682 (Human, PEA15)
Synonyms:
PEA15, Pea15, pea15.L, pea15
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3465638
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
phosphoprotein Enriched in Astrocytes 15 (PEA15)
Gene ID:
100145359 (Xenopus tropicalis, PEA15)
Synonyms:
PEA15, Pea15, pea15.L, pea15
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3873782
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
phosphoprotein Enriched in Astrocytes 15 (PEA15)
Gene ID:
8682 (Human, PEA15)
Synonyms:
PEA15, Pea15, pea15.L, pea15
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4211732
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
phosphoprotein Enriched in Astrocytes 15 (PEA15)
Gene ID:
8682 (Human, PEA15)
Synonyms:
PEA15, Pea15, pea15.L, pea15
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4087863
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
phosphoprotein Enriched in Astrocytes 15 (PEA15)
Gene ID:
510586 (Cow (Bovine), PEA15)
Synonyms:
PEA15, Pea15, pea15.L, pea15
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4062145
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
phosphoprotein Enriched in Astrocytes 15 (PEA15)
Gene ID:
734852 (Xenopus laevis, PEA15)
Synonyms:
PEA15, Pea15, pea15.L, pea15
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4068503
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
phosphoprotein Enriched in Astrocytes 15 (PEA15)
Gene ID:
8682 (Human, PEA15)
Synonyms:
PEA15, Pea15, pea15.L, pea15
Insert length:
393 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5313003
$179.56
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
ORF
Application:
Cloning
Gene:
phosphoprotein Enriched in Astrocytes 15 (PEA15)
Gene ID:
8682 (Human, PEA15)
Synonyms:
PEA15, Pea15, pea15.L, pea15
Insert length:
393 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5315249
$179.56
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
  • <
  • 1

Synonyms and alternative names related to PEA15

  • proliferation and apoptosis adaptor protein 15 (PEA15)
  • proliferation and apoptosis adaptor protein 15 (Pea15)
  • phosphoprotein enriched in astrocytes 15 (PEA15)
  • proliferation and apoptosis adaptor protein 15 L homeolog (pea15.L)
  • proliferation and apoptosis adaptor protein 15 (pea15)
  • Astrocytic phosphoprotein PEA-15 (pea15)
  • phosphoprotein enriched in astrocytes 15 (pea15)
  • DKFZp459O1410
  • HMAT1
  • HUMMAT1H
  • MAT1
  • MAT1H
  • PEA-15
  • PEA15
  • Pea15a
  • PED

Gene-IDs for different species

GENE IDSPECIES
8682 Homo sapiens
364052 Rattus norvegicus
510586 Bos taurus
610113 Canis lupus familiaris
705026 Macaca mulatta
734852 Xenopus laevis
100145359 Xenopus (Silurana) tropicalis
100152480 Sus scrofa
100174153 Pongo abelii
100286636 Salmo salar
100730336 Cavia porcellus
557745 Danio rerio

Protein level used designations for PEA15

  • 15 kDa phosphoprotein enriched in astrocytes
  • Phosphoprotein enriched in astrocytes, 15kD
  • astrocytic phosphoprotein PEA-15
  • homolog of mouse MAT-1 oncogene
  • phosphoprotein enriched in diabetes
  • phosphoprotein enriched in astrocytes 15A
  • phosphoprotein enriched in astrocytes 15
  • Astrocytic phosphoprotein PEA-15
Other products related to PEA15 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com