PEX5 (Peroxisomal Biogenesis Factor 5, PEX5)

Short Description: The product of this gene binds to the C-terminal PTS1-type tripeptide peroxisomal targeting signal (SKL-type) and plays an essential role in peroxisomal protein import. Peroxins (PEXs) are proteins that are essential for the assembly of functional peroxisomes. The peroxisome biogenesis disorders (PBDs) are a group of genetically heterogeneous autosomal recessive, lethal diseases characterized by multiple defects in peroxisome function. The peroxisomal biogenesis disorders are a heterogeneous group with at least 14 complementation groups and with more than 1 phenotype being observed in cases falling into particular complementation groups. Although the clinical features of PBD patients vary, cells from all PBD patients exhibit a defect in the import of one or more classes of peroxisomal matrix proteins into the organelle. Defects in this gene are a cause of neonatal adrenoleukodystrophy (NALD), a cause of Zellweger syndrome (ZWS) as well as may be a cause of infantile Refsum disease (IRD). Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008].
More information related to gene PEX5.
Products related to PEX5 Gene:
160 Products
Data Quality
  • 2
Type
  • 156
  • 4
Species
  • 77
  • 59
  • 18
  • 2
  • 2
Application
  • 112
  • 33
  • 20
  • 16
  • 1
Fusion tag
  • 48
  • 22
  • 19
  • 16
  • 9
Vector Backbone
  • 15
  • 10
  • 10
  • 6
  • 6
Vector
  • 83
  • 42
  • 16
  • 6
  • 5
Insert
  • 70
  • 53
  • 17
  • 8
  • 6
Oligo-Type
  • 3
  • 1
Resistance Gene
  • 78
  • 49
  • 24
  • 5
  • 2
Expression Type
  • 125
  • 57
  • 26
Selectable Marker
  • 43
  • 26
  • 22
Promoter
  • 56
  • 45
  • 27
  • 17
  • 8
Format
  • 86
  • 36
  • 22
  • 16

Type:
ORF
Application:
Cloning
Gene:
Peroxisomal Biogenesis Factor 5 (PEX5)
Species:
Human
Synonyms:
pex5, Pex5, PEX5
Insert length:
1896 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5761246
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Peroxisomal Biogenesis Factor 5 (PEX5)
NCBI Accession:
NM_001131025,NP_001124497
Species:
Human
Synonyms:
pex5, Pex5, PEX5
Insert length:
1920 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5468679
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Peroxisomal Biogenesis Factor 5 (PEX5)
Gene ID:
5830 (Human, PEX5)
Synonyms:
pex5, Pex5, PEX5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3805122
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Peroxisomal Biogenesis Factor 5 (PEX5)
Gene ID:
19305 (Mouse (Murine), PEX5)
Synonyms:
pex5, Pex5, PEX5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3810256
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Peroxisomal Biogenesis Factor 5 (PEX5)
Gene ID:
514832 (Cow (Bovine), PEX5)
Synonyms:
pex5, Pex5, PEX5
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4062927
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Peroxisomal Biogenesis Factor 5 (PEX5)
Gene ID:
496849 (Xenopus tropicalis, PEX5)
Synonyms:
pex5, Pex5, PEX5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3983632
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Peroxisomal Biogenesis Factor 5 (PEX5)
Species:
Human
Synonyms:
pex5, Pex5, PEX5
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3563379
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Peroxisomal Biogenesis Factor 5 (PEX5)
NCBI Accession:
NM_175933
Species:
Mouse (Murine)
Synonyms:
pex5, Pex5, PEX5
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3563380
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Peroxisomal Biogenesis Factor 5
Species:
Human
Synonyms:
AW212715, ESTM1, PTS1R, Pxr1, X83306, PTS1-BP, PBD2A, PBD2B, PXR1, Peroxin-5
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3192047
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Peroxisomal Biogenesis Factor 5 (PEX5)
Gene ID:
5830 (Human, PEX5)
Synonyms:
pex5, Pex5, PEX5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3805123
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Peroxisomal Biogenesis Factor 5 (PEX5)
Gene ID:
19305 (Mouse (Murine), PEX5)
Synonyms:
pex5, Pex5, PEX5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3810255
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Peroxisomal Biogenesis Factor 5 (PEX5)
Gene ID:
514832 (Cow (Bovine), PEX5)
Synonyms:
pex5, Pex5, PEX5
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4062928
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Peroxisomal Biogenesis Factor 5 (PEX5)
Gene ID:
496849 (Xenopus tropicalis, PEX5)
Synonyms:
pex5, Pex5, PEX5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3983631
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Peroxisomal Biogenesis Factor 5 (PEX5)
Gene ID:
5830 (Human, PEX5)
Synonyms:
pex5, Pex5, PEX5
Insert length:
1896 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5317916
$199.17
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Peroxisomal Biogenesis Factor 5 (PEX5)
Species:
Human
Synonyms:
pex5, Pex5, PEX5
Insert length:
1896 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4440400
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Peroxisomal Biogenesis Factor 5 (PEX5)
Species:
Human
Synonyms:
pex5, Pex5, PEX5
Insert length:
1896 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4708238
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Peroxisomal Biogenesis Factor 5 (PEX5)
Species:
Human
Synonyms:
pex5, Pex5, PEX5
Insert length:
1896 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4837368
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Peroxisomal Biogenesis Factor 5 (PEX5)
Species:
Human
Synonyms:
pex5, Pex5, PEX5
Insert length:
1896 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4622776
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Peroxisomal Biogenesis Factor 5 (PEX5)
Species:
Human
Synonyms:
pex5, Pex5, PEX5
Insert length:
1896 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4479305
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Peroxisomal Biogenesis Factor 5 (PEX5)
Species:
Human
Synonyms:
pex5, Pex5, PEX5
Insert length:
1896 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4770973
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to PEX5

  • peroxisomal biogenesis factor 5 (pex5)
  • peroxisomal biogenesis factor 5 (Pex5)
  • peroxisomal biogenesis factor 5 (PEX5)
  • AW212715
  • ESTM1
  • PBD2A
  • PBD2B
  • Peroxin-5
  • PTS1-BP
  • PTS1R
  • Pxr1
  • PXR1
  • X83306

Gene-IDs for different species

GENE IDSPECIES
496849 Xenopus (Silurana) tropicalis
19305 Mus musculus
312703 Rattus norvegicus
5830 Homo sapiens
486710 Canis lupus familiaris
514832 Bos taurus
418299 Gallus gallus
100135597 Cavia porcellus
100689015 Cricetulus griseus

Protein level used designations for PEX5

  • peroxisome biogenesis factor 5
  • PTS1 receptor
  • PTS1-BP
  • PXR1P
  • peroxin 5
  • peroxisomal C-terminal targeting signal import receptor
  • peroxisomal targeting signal 1 receptor
  • peroxisome receptor 1
  • peroxin-5
  • peroxisomal targeting signal 1 (SKL type) receptor
  • peroxisomal targeting signal import receptor
  • peroxisomal targeting signal receptor 1
  • PTS1R
  • Peroxisomal C-terminal targeting signal import receptor
  • Peroxisome receptor 1
Other products related to PEX5 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com