PNPLA3 (Patatin-Like phospholipase Domain Containing 3, PNPLA3)

Short Description: The protein encoded by this gene is a triacylglycerol lipase that mediates triacylglycerol hydrolysis in adipocytes. The encoded protein, which appears to be membrane bound, may be involved in the balance of energy usage/storage in adipocytes. [provided by RefSeq, Jul 2008].
More information related to gene PNPLA3.
Products related to PNPLA3 Gene:
98 Products
Data Quality
  • 1
Type
  • 95
  • 3
Species
  • 49
  • 28
  • 15
  • 2
  • 2
Application
  • 58
  • 27
  • 16
  • 12
  • 1
Fusion tag
  • 35
  • 11
  • 11
  • 8
  • 6
Vector Backbone
  • 4
  • 4
  • 4
  • 4
  • 4
Vector
  • 42
  • 25
  • 12
  • 6
  • 5
Insert
  • 37
  • 32
  • 14
  • 6
  • 4
Oligo-Type
  • 2
  • 1
Resistance Gene
  • 42
  • 33
  • 12
  • 8
  • 2
Expression Type
  • 77
  • 39
  • 11
Selectable Marker
  • 22
  • 18
  • 11
  • 1
Promoter
  • 26
  • 25
  • 22
  • 13
  • 6
Format
  • 40
  • 27
  • 16
  • 15

Type:
ORF
Application:
Cloning
Gene:
Patatin-Like phospholipase Domain Containing 3 (PNPLA3)
Species:
Human
Synonyms:
PNPLA3, Pnpla3
Insert length:
312 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5756845
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Cloning
Gene:
Patatin-Like phospholipase Domain Containing 3 (PNPLA3)
Species:
Human
Synonyms:
PNPLA3, Pnpla3
Insert length:
1446 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5756846
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Patatin-Like phospholipase Domain Containing 3 (PNPLA3)
Gene ID:
436610 (Zebrafish (Danio rerio), PNPLA3)
Synonyms:
PNPLA3, Pnpla3
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4057664
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Patatin-Like phospholipase Domain Containing 3 (PNPLA3)
Gene ID:
548410 (Xenopus tropicalis, PNPLA3)
Synonyms:
PNPLA3, Pnpla3
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4065242
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Patatin-Like phospholipase Domain Containing 3 (PNPLA3)
Gene ID:
116939 (Mouse (Murine), PNPLA3)
Synonyms:
PNPLA3, Pnpla3
Vector type:
Cloning Vector
Vector backbone:
pT7T3D-PacI
Resistance Gene:
Ampicillin
Promoter:
T3 Promoter

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4097927
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Patatin-Like phospholipase Domain Containing 3 (PNPLA3)
Gene ID:
80339 (Human, PNPLA3)
Synonyms:
PNPLA3, Pnpla3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3827088
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Patatin-Like phospholipase Domain Containing 3 (PNPLA3)
Gene ID:
447273 (Xenopus laevis, PNPLA3)
Synonyms:
PNPLA3, Pnpla3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3852078
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Patatin-Like phospholipase Domain Containing 3 (PNPLA3)
NCBI Accession:
NM_001282324
Species:
Rat (Rattus)
Synonyms:
PNPLA3, Pnpla3
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3633104
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Patatin-Like phospholipase Domain Containing 3
Species:
Rat (Rattus)
Synonyms:
ADPN, C22orf20, iPLA(2)epsilon, Adpn
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3196705
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Patatin-Like phospholipase Domain Containing 3 (PNPLA3)
Gene ID:
436610 (Zebrafish (Danio rerio), PNPLA3)
Synonyms:
PNPLA3, Pnpla3
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4057663
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Patatin-Like phospholipase Domain Containing 3 (PNPLA3)
Gene ID:
548410 (Xenopus tropicalis, PNPLA3)
Synonyms:
PNPLA3, Pnpla3
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4065241
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Patatin-Like phospholipase Domain Containing 3 (PNPLA3)
Gene ID:
80339 (Human, PNPLA3)
Synonyms:
PNPLA3, Pnpla3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3827087
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Patatin-Like phospholipase Domain Containing 3 (PNPLA3)
Gene ID:
447273 (Xenopus laevis, PNPLA3)
Synonyms:
PNPLA3, Pnpla3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3852079
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Patatin-Like phospholipase Domain Containing 3 (PNPLA3)
Gene ID:
80339 (Human, PNPLA3)
Synonyms:
PNPLA3, Pnpla3
Insert length:
312 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5312925
$179.56
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
ORF
Application:
Cloning
Gene:
Patatin-Like phospholipase Domain Containing 3 (PNPLA3)
Gene ID:
80339 (Human, PNPLA3)
Synonyms:
PNPLA3, Pnpla3
Insert length:
1446 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5320736
$189.37
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Patatin-Like phospholipase Domain Containing 3 (PNPLA3)
NCBI Accession:
NM_001282324
Species:
Rat (Rattus)
Synonyms:
PNPLA3, Pnpla3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3633093
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Patatin-Like phospholipase Domain Containing 3 (PNPLA3)
NCBI Accession:
NM_001282324
Species:
Rat (Rattus)
Synonyms:
PNPLA3, Pnpla3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948170

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3633099
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Patatin-Like phospholipase Domain Containing 3 (PNPLA3)
NCBI Accession:
NM_001282324
Species:
Rat (Rattus)
Synonyms:
PNPLA3, Pnpla3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948165

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3633096
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Patatin-Like phospholipase Domain Containing 3 (PNPLA3)
NCBI Accession:
NM_001282324
Species:
Rat (Rattus)
Synonyms:
PNPLA3, Pnpla3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948164

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3633097
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Patatin-Like phospholipase Domain Containing 3 (PNPLA3)
NCBI Accession:
NM_001282324
Species:
Rat (Rattus)
Synonyms:
PNPLA3, Pnpla3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948173

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3633101
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to PNPLA3

  • patatin like phospholipase domain containing 3 (PNPLA3)
  • patatin-like phospholipase domain containing 3 (Pnpla3)
  • ADPN
  • Adpn
  • C22orf20
  • iPLA(2)epsilon

Gene-IDs for different species

GENE IDSPECIES
80339 Homo sapiens
116939 Mus musculus
362972 Rattus norvegicus

Protein level used designations for PNPLA3

  • acylglycerol O-acyltransferase
  • adiponutrin
  • calcium-independent phospholipase A2-epsilon
  • iPLA2-epsilon
  • iPLA2epsilon
  • patatin-like phospholipase domain-containing protein 3
Other products related to PNPLA3 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com