Progesterone Receptor (Progesterone Receptor, PGR)

Short Description: This gene encodes a member of the steroid receptor superfamily. The encoded protein mediates the physiological effects of progesterone, which plays a central role in reproductive events associated with the establishment and maintenance of pregnancy. This gene uses two distinct promotors and translation start sites in the first exon to produce two isoforms, A and B. The two isoforms are identical except for the additional 165 amino acids found in the N-terminus of isoform B and mediate their own response genes and physiologic effects with little overlap. [provided by RefSeq, Jan 2011].
More information related to gene Progesterone Receptor.
Products related to Progesterone Receptor Gene:
108 Products
Type
  • 105
  • 3
Species
  • 53
  • 27
  • 26
  • 2
Application
  • 70
  • 23
  • 16
  • 13
Fusion tag
  • 29
  • 18
  • 13
  • 11
  • 8
Vector Backbone
  • 7
  • 6
  • 6
  • 6
  • 6
Vector
  • 45
  • 35
  • 12
  • 9
  • 2
Insert
  • 36
  • 33
  • 20
  • 8
  • 6
Oligo-Type
  • 3
Resistance Gene
  • 48
  • 38
  • 18
  • 2
  • 1
Expression Type
  • 88
  • 51
  • 13
Selectable Marker
  • 29
  • 26
  • 13
Promoter
  • 36
  • 30
  • 21
  • 14
  • 8
Format
  • 53
  • 24
  • 22
  • 9

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Progesterone Receptor (PGR)
Gene ID:
373633 (Xenopus laevis, PGR)
Synonyms:
PGR, Pgr, pgr.L, pgr
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3841617
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Progesterone Receptor (PGR)
Gene ID:
18667 (Mouse (Murine), PGR)
Synonyms:
PGR, Pgr, pgr.L, pgr
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4003504
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Progesterone Receptor (PGR)
NCBI Accession:
NM_001202474
Species:
Human
Synonyms:
PGR, Pgr, pgr.L, pgr
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3563432
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Progesterone Receptor (PGR)
Gene ID:
373633 (Xenopus laevis, PGR)
Synonyms:
PGR, Pgr, pgr.L, pgr
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3841616
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Progesterone Receptor (PGR)
Gene ID:
18667 (Mouse (Murine), PGR)
Synonyms:
PGR, Pgr, pgr.L, pgr
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4003505
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Progesterone Receptor (PGR)
NCBI Accession:
NM_001202474
Species:
Human
Synonyms:
PGR, Pgr, pgr.L, pgr
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948163

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3629814
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Progesterone Receptor (PGR)
NCBI Accession:
NM_001202474
Species:
Human
Synonyms:
PGR, Pgr, pgr.L, pgr
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948165

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3629815
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Progesterone Receptor (PGR)
NCBI Accession:
NM_001202474
Species:
Human
Synonyms:
PGR, Pgr, pgr.L, pgr
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948164

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3629816
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Progesterone Receptor (PGR)
NCBI Accession:
NM_001202474
Species:
Human
Synonyms:
PGR, Pgr, pgr.L, pgr
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948168

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3629822
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Progesterone Receptor (PGR)
NCBI Accession:
NM_001202474
Species:
Human
Synonyms:
PGR, Pgr, pgr.L, pgr
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948167

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3629820
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Progesterone Receptor (PGR)
NCBI Accession:
NM_001202474
Species:
Human
Synonyms:
PGR, Pgr, pgr.L, pgr
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-untagged
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948161

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3629824
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Progesterone Receptor (PGR)
NCBI Accession:
NM_001202474
Species:
Human
Synonyms:
PGR, Pgr, pgr.L, pgr
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3629812
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Progesterone Receptor (PGR)
NCBI Accession:
NM_001202474
Species:
Human
Synonyms:
PGR, Pgr, pgr.L, pgr
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948166

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3629818
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Progesterone Receptor (PGR)
NCBI Accession:
NM_001202474
Species:
Human
Synonyms:
PGR, Pgr, pgr.L, pgr
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948169

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3629821
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Progesterone Receptor (PGR)
Gene ID:
5241 (Human, PGR)
Synonyms:
PGR, Pgr, pgr.L, pgr
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR223-1
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3416474
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Progesterone Receptor (PGR)
NCBI Accession:
NM_001271162
Gene ID:
5241 (Human, PGR)
Synonyms:
PGR, Pgr, pgr.L, pgr
Insert length:
1020 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4936663
$319.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Progesterone Receptor (PGR)
NCBI Accession:
NM_001202474
Species:
Human
Synonyms:
PGR, Pgr, pgr.L, pgr
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-GFPSpark
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
GFPSpark
Expression:
Transient,Stable

Empty vector controls:
ABIN4948177

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3629819
$338.24
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Progesterone Receptor (PGR)
NCBI Accession:
NM_001202474
Species:
Human
Synonyms:
PGR, Pgr, pgr.L, pgr
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-OFPSpark
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
OFPSpark
Expression:
Transient,Stable

Empty vector controls:
ABIN4948175

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3629817
$338.24
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Progesterone Receptor (PGR)
NCBI Accession:
NM_001202474
Species:
Human
Synonyms:
PGR, Pgr, pgr.L, pgr
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-GFPSpark
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
GFPSpark
Expression:
Transient,Stable

Empty vector controls:
ABIN4948176

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3629813
$338.24
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Progesterone Receptor (PGR)
NCBI Accession:
NM_001202474
Species:
Human
Synonyms:
PGR, Pgr, pgr.L, pgr
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-N-OFPSpark
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
OFPSpark
Expression:
Transient,Stable

Empty vector controls:
ABIN4948174

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3629823
$338.24
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to Progesterone Receptor

  • progesterone receptor (PGR)
  • progesterone receptor (Pgr)
  • progesterone receptor L homeolog (pgr.L)
  • progesterone receptor (pgr)
  • 9930019P03Rik
  • BB114106
  • ENSMUSG00000074510
  • gb:dq017620
  • LOC443444
  • NR3C3
  • pg
  • pgr
  • PGR
  • PR
  • pr
  • PR-A
  • PR-B
  • XPR-1
  • xpr-2

Gene-IDs for different species

GENE IDSPECIES
5241 Homo sapiens
18667 Mus musculus
25154 Rattus norvegicus
373633 Xenopus laevis
396198 Gallus gallus
396805 Sus scrofa
403621 Canis lupus familiaris
443444 Ovis aries
451502 Pan troglodytes
493830 Felis catus
569575 Danio rerio
613024 Macaca mulatta
100009094 Oryctolagus cuniculus
100033883 Equus caballus
100144430 Taeniopygia guttata
100303420 Papio anubis
100335138 Oryzias latipes
100481387 Ailuropoda melanoleuca
100724945 Cavia porcellus
100989324 Pan paniscus

Protein level used designations for Progesterone Receptor

  • nuclear receptor subfamily 3 group C member 3
  • PR
  • p4 receptor
  • Nuclear receptor subfamily 3 group C member 3
  • progesterone receptor
  • NR3C3
  • nuclear progesterone receptor Pgr
Other products related to Progesterone Receptor such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com