RED1 (Adenosine Deaminase, RNA-Specific, B1, ADARB1)

Short Description: This gene encodes the enzyme responsible for pre-mRNA editing of the glutamate receptor subunit B by site-specific deamination of adenosines. Studies in rat found that this enzyme acted on its own pre-mRNA molecules to convert an AA dinucleotide to an AI dinucleotide which resulted in a new splice site. Alternative splicing of this gene results in several transcript variants, some of which have been characterized by the presence or absence of an ALU cassette insert and a short or long C-terminal region. [provided by RefSeq, Jul 2008].
More information related to gene RED1.
Products related to RED1 Gene:
  • 164
  • 3
  • 69
  • 53
  • 41
  • 2
  • 2
  • 109
  • 41
  • 19
  • 16
Fusion tag
  • 42
  • 28
  • 28
  • 21
  • 7
Vector Backbone
  • 18
  • 18
  • 16
  • 7
  • 7
  • 61
  • 57
  • 28
  • 9
  • 7
  • 71
  • 61
  • 16
  • 8
  • 6
  • 3
Resistance Gene
  • 75
  • 42
  • 38
  • 9
  • 2
Expression Type
  • 162
  • 67
Selectable Marker
  • 51
  • 24
  • 80
  • 28
  • 28
  • 17
  • 8
  • 63
  • 62
  • 31
  • 11
167 Products

Protein Expression, Cloning
Adenosine Deaminase, RNA-Specific, B1 (ADARB1)
Gene ID:
100124739 (Xenopus tropicalis, ADARB1)
ADARB1, adarb1, adarb1.L, Adarb1, adarb1a
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3872491
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Adenosine Deaminase, RNA-Specific, B1 (ADARB1)
Gene ID:
495438 (Xenopus laevis, ADARB1)
ADARB1, adarb1, adarb1.L, Adarb1, adarb1a
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3983205
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Adenosine Deaminase, RNA-Specific, B1 (ADARB1)
Gene ID:
104 (Human, ADARB1)
ADARB1, adarb1, adarb1.L, Adarb1, adarb1a
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3803105
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Adenosine Deaminase, RNA-Specific, B1 (ADARB1)
Gene ID:
100124739 (Xenopus tropicalis, ADARB1)
ADARB1, adarb1, adarb1.L, Adarb1, adarb1a
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3872492
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Adenosine Deaminase, RNA-Specific, B1 (ADARB1)
Gene ID:
495438 (Xenopus laevis, ADARB1)
ADARB1, adarb1, adarb1.L, Adarb1, adarb1a
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3983206
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Adenosine Deaminase, RNA-Specific, B1 (ADARB1)
Gene ID:
104 (Human, ADARB1)
ADARB1, adarb1, adarb1.L, Adarb1, adarb1a
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3803103
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression
Adenosine Deaminase, RNA-Specific, B1 (ADARB1)
Gene ID:
110532 (Mouse (Murine), ADARB1)
ADARB1, adarb1, adarb1.L, Adarb1, adarb1a
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3433778
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression
Adenosine Deaminase, RNA-Specific, B1 (ADARB1)
Gene ID:
104 (Human, ADARB1)
ADARB1, adarb1, adarb1.L, Adarb1, adarb1a
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3413092
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Genome Editing with Engineered Nucleases, Protein Expression
Adenosine Deaminase, RNA-Specific, B1 (ADARB1)
NCBI Accession:
ADARB1, adarb1, adarb1.L, Adarb1, adarb1a
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ADARB1
Viral Particles
-80 °C
Catalog No. ABIN5113506
300 μL
Plus shipping costs $45.00 and $22.00 dry ice

Genome Editing with Engineered Nucleases, Protein Expression
Adenosine Deaminase, RNA-Specific, B1 (ADARB1)
Mouse (Murine)
ADARB1, adarb1, adarb1.L, Adarb1, adarb1a
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Adarb1
Viral Particles
-80 °C
Catalog No. ABIN5113508
300 μL
Plus shipping costs $45.00 and $22.00 dry ice

Genome Editing with Engineered Nucleases, Protein Expression
Adenosine Deaminase, RNA-Specific, B1 (ADARB1)
NCBI Accession:
Rat (Rattus)
ADARB1, adarb1, adarb1.L, Adarb1, adarb1a
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Adarb1
Viral Particles
-80 °C
Catalog No. ABIN5113510
300 μL
Plus shipping costs $45.00 and $22.00 dry ice

Protein Expression
Adenosine Deaminase, RNA-Specific, B1 (ADARB1)
NCBI Accession:
ADARB1, adarb1, adarb1.L, Adarb1, adarb1a
Insert length:
2106 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5391790
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

RNA Interference
Adenosine Deaminase, RNA-Specific, B1
Rat (Rattus)
ADARB1, RED1, ADAR2, DRABA2, DRADA2, 1700057H01Rik, AW124433, AW558573, Adar2, BB220382, D10Bwg0447e, Red1, adar2, adarb1, red1
HPLC purified
Available with shipment
  • Adarb1 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3350723
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

RNA Interference
Adenosine Deaminase, RNA-Specific, B1
ADARB1, RED1, ADAR2, DRABA2, DRADA2, 1700057H01Rik, AW124433, AW558573, Adar2, BB220382, D10Bwg0447e, Red1, adar2, adarb1, red1
HPLC purified
Available with shipment
  • ADARB1 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3339864
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

RNA Interference
Adenosine Deaminase, RNA-Specific, B1
Mouse (Murine)
ADARB1, RED1, ADAR2, DRABA2, DRADA2, 1700057H01Rik, AW124433, AW558573, Adar2, BB220382, D10Bwg0447e, Red1, adar2, adarb1, red1
HPLC purified
Available with shipment
  • Adarb1 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3263492
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Protein Expression
Adenosine Deaminase, RNA-Specific, B1 (ADARB1)
ADARB1, adarb1, adarb1.L, Adarb1, adarb1a
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
GFP tag
Stable, Transient

The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5391786
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Genome Editing with Engineered Nucleases
Adenosine Deaminase, RNA-Specific, B1 (ADARB1)
Gene ID:
104 (Human, ADARB1)
ADARB1, adarb1, adarb1.L, Adarb1, adarb1a
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
SFFV Promoter, U6 Promoter
Fusion Tag:
Transient, Stable

Viral particles:

- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Glycerol Stock
-80 °C
Catalog No. ABIN5028576
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Adenosine Deaminase, RNA-Specific, B1 (ADARB1)
NCBI Accession:
ADARB1, adarb1, adarb1.L, Adarb1, adarb1a
Insert length:
2226 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5737735
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

gRNA + Cas9
Genome Editing with Engineered Nucleases, Protein Expression
Adenosine Deaminase, RNA-Specific, B1 (ADARB1)
NCBI Accession:
ADARB1, adarb1, adarb1.L, Adarb1, adarb1a
Vector type:
Lentiviral Vector
Resistance Gene:
Selection Marker:
U6 Promoter, SFFV Promoter
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ADARB1
Viral Particles
-80 °C
Catalog No. ABIN5228840
300 μL
Plus shipping costs $45.00 and $22.00 dry ice

gRNA + Cas9
Genome Editing with Engineered Nucleases, Protein Expression
Adenosine Deaminase, RNA-Specific, B1 (ADARB1)
Mouse (Murine)
ADARB1, adarb1, adarb1.L, Adarb1, adarb1a
Vector type:
Lentiviral Vector
Resistance Gene:
Selection Marker:
U6 Promoter, SFFV Promoter
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Adarb1
Viral Particles
-80 °C
Catalog No. ABIN5228842
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
  • <
  • 1

Synonyms and alternative names related to RED1

  • adenosine deaminase, RNA specific B1 (ADARB1)
  • adenosine deaminase, RNA-specific, B1 (adarb1)
  • adenosine deaminase, RNA-specific, B1 L homeolog (adarb1.L)
  • adenosine deaminase, RNA-specific, B1 (Adarb1)
  • adenosine deaminase, RNA-specific, B1a (adarb1a)
  • 1700057H01Rik
  • ADAR2
  • Adar2
  • adar2
  • ADARB1
  • adarb1
  • AW124433
  • AW558573
  • BB220382
  • D10Bwg0447e
  • DRABA2
  • DRADA2
  • RED1
  • Red1
  • red1

Gene-IDs for different species

521761 Bos taurus
100124739 Xenopus (Silurana) tropicalis
100339367 Oryctolagus cuniculus
100483845 Ailuropoda melanoleuca
100589130 Nomascus leucogenys
495438 Xenopus laevis
374087 Gallus gallus
104 Homo sapiens
487809 Canis lupus familiaris
110532 Mus musculus
25367 Rattus norvegicus
58134 Danio rerio

Protein level used designations for RED1

  • adenosine deaminase, RNA-specific, B1 (RED1 homolog rat)
  • adenosine deaminase, RNA-specific, B1 (RED1 homolog)
  • adenosine deaminase, RNA-specific, B1
  • RNA-specific adenosine deaminase B1
  • double-stranded RNA-specific editase 1-like
  • RED1 homolog
  • RNA editase
  • RNA editing deaminase 1
  • RNA-editing deaminase 1
  • RNA-editing enzyme 1
  • adenosine deaminase, RNA-specific, B1 (homolog of rat RED1)
  • double-stranded RNA-specific editase 1
  • dsRNA adenosine deaminase DRADA2
  • dsRNA adenosine deaminase
  • RNA editing deaminase of glutamate receptors
  • double-stranded RNA-specific editase
Other products related to RED1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website