RED1 (Adenosine Deaminase, RNA-Specific, B1, ADARB1)

Short Description: This gene encodes the enzyme responsible for pre-mRNA editing of the glutamate receptor subunit B by site-specific deamination of adenosines. Studies in rat found that this enzyme acted on its own pre-mRNA molecules to convert an AA dinucleotide to an AI dinucleotide which resulted in a new splice site. Alternative splicing of this gene results in several transcript variants, some of which have been characterized by the presence or absence of an ALU cassette insert and a short or long C-terminal region. [provided by RefSeq, Jul 2008].
More information related to gene RED1.
Products related to RED1 Gene:
173 Products
Type
  • 167
  • 6
Species
  • 71
  • 55
  • 43
  • 2
  • 2
Application
  • 109
  • 41
  • 25
  • 16
Fusion tag
  • 45
  • 31
  • 28
  • 21
  • 7
Vector Backbone
  • 18
  • 18
  • 16
  • 7
  • 7
Vector
  • 64
  • 57
  • 28
  • 9
  • 7
Insert
  • 71
  • 61
  • 19
  • 8
  • 6
Oligo-Type
  • 6
Resistance Gene
  • 78
  • 42
  • 38
  • 9
  • 2
Expression Type
  • 165
  • 70
Selectable Marker
  • 54
  • 24
Promoter
  • 83
  • 31
  • 28
  • 17
  • 8
Format
  • 68
  • 63
  • 31
  • 11

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Adenosine Deaminase, RNA-Specific, B1 (ADARB1)
Gene ID:
104 (Human, ADARB1)
Synonyms:
ADARB1, adarb1, adarb1.L, Adarb1, adarb1a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3803105
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Adenosine Deaminase, RNA-Specific, B1 (ADARB1)
Gene ID:
100124739 (Xenopus tropicalis, ADARB1)
Synonyms:
ADARB1, adarb1, adarb1.L, Adarb1, adarb1a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3872491
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Adenosine Deaminase, RNA-Specific, B1 (ADARB1)
Gene ID:
495438 (Xenopus laevis, ADARB1)
Synonyms:
ADARB1, adarb1, adarb1.L, Adarb1, adarb1a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3983205
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Adenosine Deaminase, RNA-Specific, B1 (ADARB1)
Gene ID:
104 (Human, ADARB1)
Synonyms:
ADARB1, adarb1, adarb1.L, Adarb1, adarb1a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3803103
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Adenosine Deaminase, RNA-Specific, B1 (ADARB1)
Gene ID:
100124739 (Xenopus tropicalis, ADARB1)
Synonyms:
ADARB1, adarb1, adarb1.L, Adarb1, adarb1a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3872492
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Adenosine Deaminase, RNA-Specific, B1 (ADARB1)
Gene ID:
495438 (Xenopus laevis, ADARB1)
Synonyms:
ADARB1, adarb1, adarb1.L, Adarb1, adarb1a
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3983206
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Adenosine Deaminase, RNA-Specific, B1 (ADARB1)
Gene ID:
110532 (Mouse (Murine), ADARB1)
Synonyms:
ADARB1, adarb1, adarb1.L, Adarb1, adarb1a
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR223-1
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3433778
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Adenosine Deaminase, RNA-Specific, B1 (ADARB1)
Gene ID:
104 (Human, ADARB1)
Synonyms:
ADARB1, adarb1, adarb1.L, Adarb1, adarb1a
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3413092
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Application:
RNA Interference
Gene:
Adenosine Deaminase, RNA-Specific, B1
Species:
Rat (Rattus)
Synonyms:
ADARB1, RED1, ADAR2, DRABA2, DRADA2, 1700057H01Rik, AW124433, AW558573, Adar2, BB220382, D10Bwg0447e, Red1, adar2, adarb1, red1
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Adarb1 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3350723
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Adenosine Deaminase, RNA-Specific, B1
Species:
Human
Synonyms:
ADARB1, RED1, ADAR2, DRABA2, DRADA2, 1700057H01Rik, AW124433, AW558573, Adar2, BB220382, D10Bwg0447e, Red1, adar2, adarb1, red1
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • ADARB1 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3339864
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Adenosine Deaminase, RNA-Specific, B1
Species:
Mouse (Murine)
Synonyms:
ADARB1, RED1, ADAR2, DRABA2, DRADA2, 1700057H01Rik, AW124433, AW558573, Adar2, BB220382, D10Bwg0447e, Red1, adar2, adarb1, red1
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Adarb1 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3263492
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Adenosine Deaminase, RNA-Specific, B1 (ADARB1)
Species:
Mouse (Murine)
Synonyms:
ADARB1, adarb1, adarb1.L, Adarb1, adarb1a
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Adarb1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5113508
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Adenosine Deaminase, RNA-Specific, B1 (ADARB1)
NCBI Accession:
NM_012894
Species:
Rat (Rattus)
Synonyms:
ADARB1, adarb1, adarb1.L, Adarb1, adarb1a
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Adarb1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5113510
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Adenosine Deaminase, RNA-Specific, B1 (ADARB1)
NCBI Accession:
NM_001033049
Species:
Human
Synonyms:
ADARB1, adarb1, adarb1.L, Adarb1, adarb1a
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ADARB1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5113506
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
ORF
Application:
Protein Expression
Gene:
Adenosine Deaminase, RNA-Specific, B1 (ADARB1)
NCBI Accession:
NM_015833,NP_056648
Species:
Human
Synonyms:
ADARB1, adarb1, adarb1.L, Adarb1, adarb1a
Insert length:
2226 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5391791
$430.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Adenosine Deaminase, RNA-Specific, B1 (ADARB1)
Gene ID:
104 (Human, ADARB1)
Synonyms:
ADARB1, adarb1, adarb1.L, Adarb1, adarb1a
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter, U6 Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Viral particles:
ABIN5047521

Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5028576
$503.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Adenosine Deaminase, RNA-Specific, B1
Gene ID:
104 (Human, ADARB1)
Synonyms:
ADARB1, RED1, ADAR2, DRABA2, DRADA2, 1700057H01Rik, AW124433, AW558573, Adar2, BB220382, D10Bwg0447e, Red1, adar2, adarb1, red1
Purification:
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
Components:
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5789295
$516.85
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days

Application:
RNA Interference
Gene:
Adenosine Deaminase, RNA-Specific, B1
Gene ID:
25367 (Rat (Rattus), ADARB1)
Synonyms:
ADARB1, RED1, ADAR2, DRABA2, DRADA2, 1700057H01Rik, AW124433, AW558573, Adar2, BB220382, D10Bwg0447e, Red1, adar2, adarb1, red1
Purification:
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
Components:
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5789296
$516.85
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days

Application:
RNA Interference
Gene:
Adenosine Deaminase, RNA-Specific, B1
Gene ID:
110532 (Mouse (Murine), ADARB1)
Synonyms:
ADARB1, RED1, ADAR2, DRABA2, DRADA2, 1700057H01Rik, AW124433, AW558573, Adar2, BB220382, D10Bwg0447e, Red1, adar2, adarb1, red1
Purification:
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
Components:
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5789297
$516.85
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Adenosine Deaminase, RNA-Specific, B1 (ADARB1)
NCBI Accession:
NM_001033049
Species:
Human
Synonyms:
ADARB1, adarb1, adarb1.L, Adarb1, adarb1a
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of ADARB1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5228840
$520.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
  • <
  • 1

Synonyms and alternative names related to RED1

  • adenosine deaminase, RNA specific B1 (ADARB1)
  • adenosine deaminase, RNA-specific, B1 (adarb1)
  • adenosine deaminase, RNA-specific, B1 L homeolog (adarb1.L)
  • adenosine deaminase, RNA-specific, B1 (Adarb1)
  • adenosine deaminase, RNA-specific, B1a (adarb1a)
  • 1700057H01Rik
  • ADAR2
  • Adar2
  • adar2
  • ADARB1
  • adarb1
  • AW124433
  • AW558573
  • BB220382
  • D10Bwg0447e
  • DRABA2
  • DRADA2
  • RED1
  • Red1
  • red1

Gene-IDs for different species

GENE IDSPECIES
521761 Bos taurus
100124739 Xenopus (Silurana) tropicalis
100339367 Oryctolagus cuniculus
100483845 Ailuropoda melanoleuca
100589130 Nomascus leucogenys
495438 Xenopus laevis
374087 Gallus gallus
104 Homo sapiens
487809 Canis lupus familiaris
110532 Mus musculus
25367 Rattus norvegicus
58134 Danio rerio

Protein level used designations for RED1

  • adenosine deaminase, RNA-specific, B1 (RED1 homolog rat)
  • adenosine deaminase, RNA-specific, B1 (RED1 homolog)
  • adenosine deaminase, RNA-specific, B1
  • RNA-specific adenosine deaminase B1
  • double-stranded RNA-specific editase 1-like
  • RED1 homolog
  • RNA editase
  • RNA editing deaminase 1
  • RNA-editing deaminase 1
  • RNA-editing enzyme 1
  • adenosine deaminase, RNA-specific, B1 (homolog of rat RED1)
  • double-stranded RNA-specific editase 1
  • dsRNA adenosine deaminase DRADA2
  • dsRNA adenosine deaminase
  • RNA editing deaminase of glutamate receptors
  • double-stranded RNA-specific editase
Other products related to RED1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com