RPS27A (Ribosomal Protein S27a, RPS27A)

Short Description: Ubiquitin, a highly conserved protein that has a major role in targeting cellular proteins for degradation by the 26S proteosome, is synthesized as a precursor protein consisting of either polyubiquitin chains or a single ubiquitin fused to an unrelated protein. This gene encodes a fusion protein consisting of ubiquitin at the N terminus and ribosomal protein S27a at the C terminus. When expressed in yeast, the protein is post-translationally processed, generating free ubiquitin monomer and ribosomal protein S27a. Ribosomal protein S27a is a component of the 40S subunit of the ribosome and belongs to the S27AE family of ribosomal proteins. It contains C4-type zinc finger domains and is located in the cytoplasm. Pseudogenes derived from this gene are present in the genome. As with ribosomal protein S27a, ribosomal protein L40 is also synthesized as a fusion protein with ubiquitin\; similarly, ribosomal protein S30 is synthesized as a fusion protein with the ubiquitin-like protein fubi. Multiple alternatively spliced transcript variants that encode the same proteins have been identified.[provided by RefSeq, Sep 2008].
More information related to gene RPS27A.
Products related to RPS27A Gene:
160 Products
Type
  • 157
  • 3
Species
  • 73
  • 55
  • 24
  • 2
  • 2
Application
  • 103
  • 45
  • 20
  • 16
Fusion tag
  • 56
  • 20
  • 16
  • 16
  • 8
Vector Backbone
  • 10
  • 10
  • 9
  • 8
  • 6
Vector
  • 73
  • 43
  • 16
  • 16
  • 6
Insert
  • 62
  • 62
  • 17
  • 8
  • 6
Oligo-Type
  • 3
Resistance Gene
  • 70
  • 52
  • 28
  • 7
  • 2
Expression Type
  • 116
  • 52
  • 26
  • 2
Selectable Marker
  • 34
  • 26
  • 22
  • 1
Promoter
  • 47
  • 45
  • 27
  • 17
  • 8
Format
  • 69
  • 36
  • 29
  • 26

Type:
ORF
Application:
Protein Expression
Gene:
Ribosomal Protein S27a (RPS27A)
NCBI Accession:
NM_002954,NP_002945
Species:
Human
Synonyms:
RPS27A, Rps27a, RpS27A, rps27a, LOC105381543, rps27a.S
Insert length:
471 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5369053
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Ribosomal Protein S27a (RPS27A)
NCBI Accession:
NM_001135592
Gene ID:
6233 (Human, RPS27A)
Synonyms:
RPS27A, Rps27a, RpS27A, rps27a, LOC105381543, rps27a.S
Insert length:
471 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4918251
$99.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ribosomal Protein S27a (RPS27A)
Gene ID:
337810 (Zebrafish (Danio rerio), RPS27A)
Synonyms:
RPS27A, Rps27a, RpS27A, rps27a, LOC105381543, rps27a.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4073299
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ribosomal Protein S27a (RPS27A)
Gene ID:
78294 (Mouse (Murine), RPS27A)
Synonyms:
RPS27A, Rps27a, RpS27A, rps27a, LOC105381543, rps27a.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3826301
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ribosomal Protein S27a (RPS27A)
Gene ID:
286839 (Cow (Bovine), RPS27A)
Synonyms:
RPS27A, Rps27a, RpS27A, rps27a, LOC105381543, rps27a.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3840235
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ribosomal Protein S27a (RPS27A)
Gene ID:
6233 (Human, RPS27A)
Synonyms:
RPS27A, Rps27a, RpS27A, rps27a, LOC105381543, rps27a.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3464803
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ribosomal Protein S27a (RPS27A)
Gene ID:
444494 (Xenopus laevis, RPS27A)
Synonyms:
RPS27A, Rps27a, RpS27A, rps27a, LOC105381543, rps27a.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3850549
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Ribosomal Protein S27a (RPS27A)
Gene ID:
78294 (Mouse (Murine), RPS27A)
Synonyms:
RPS27A, Rps27a, RpS27A, rps27a, LOC105381543, rps27a.S
Vector type:
Cloning Vector
Vector backbone:
pYX-Asc
Resistance Gene:
Ampicillin
Promoter:
T3 Promoter

Sequencing Primer:
  • T7
  • T3
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4101650
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Ribosomal Protein S27a (RPS27A)
Gene ID:
6233 (Human, RPS27A)
Synonyms:
RPS27A, Rps27a, RpS27A, rps27a, LOC105381543, rps27a.S
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4086679
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Ribosomal Protein S27a (RPS27A)
Gene ID:
81777 (Rat (Rattus), RPS27A)
Synonyms:
RPS27A, Rps27a, RpS27A, rps27a, LOC105381543, rps27a.S
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4039224
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ribosomal Protein S27a (RPS27A)
Gene ID:
548926 (Xenopus tropicalis, RPS27A)
Synonyms:
RPS27A, Rps27a, RpS27A, rps27a, LOC105381543, rps27a.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS108
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4030177
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Ribosomal Protein S27a (RPS27A)
Gene ID:
6233 (Human, RPS27A)
Synonyms:
RPS27A, Rps27a, RpS27A, rps27a, LOC105381543, rps27a.S
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3469321
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Ribosomal Protein S27a (RPS27A)
Gene ID:
6233 (Human, RPS27A)
Synonyms:
RPS27A, Rps27a, RpS27A, rps27a, LOC105381543, rps27a.S
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3469322
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Ribosomal Protein S27a (RPS27A)
NCBI Accession:
NM_001177413
Species:
Human
Synonyms:
RPS27A, Rps27a, RpS27A, rps27a, LOC105381543, rps27a.S
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3564590
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Ribosomal Protein S27a (RPS27A)
Species:
Mouse (Murine)
Synonyms:
RPS27A, Rps27a, RpS27A, rps27a, LOC105381543, rps27a.S
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3564591
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ribosomal Protein S27a (RPS27A)
Gene ID:
337810 (Zebrafish (Danio rerio), RPS27A)
Synonyms:
RPS27A, Rps27a, RpS27A, rps27a, LOC105381543, rps27a.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4073298
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Ribosomal Protein S27a (RPS27A)
Species:
Human
Synonyms:
RPS27A, Rps27a, RpS27A, rps27a, LOC105381543, rps27a.S
Insert length:
471 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5730620
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ribosomal Protein S27a (RPS27A)
Gene ID:
78294 (Mouse (Murine), RPS27A)
Synonyms:
RPS27A, Rps27a, RpS27A, rps27a, LOC105381543, rps27a.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3826302
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ribosomal Protein S27a (RPS27A)
Gene ID:
286839 (Cow (Bovine), RPS27A)
Synonyms:
RPS27A, Rps27a, RpS27A, rps27a, LOC105381543, rps27a.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3840236
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Ribosomal Protein S27a (RPS27A)
Gene ID:
6233 (Human, RPS27A)
Synonyms:
RPS27A, Rps27a, RpS27A, rps27a, LOC105381543, rps27a.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3464804
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to RPS27A

  • ribosomal protein S27a (RPS27A)
  • ribosomal protein S27A (Rps27a)
  • Ribosomal protein S27A (RpS27A)
  • ribosomal protein S27a (Rps27a)
  • ribosomal protein S27a (rps27a)
  • ubiquitin-40S ribosomal protein S27a (LOC105381543)
  • ribosomal protein S27a S homeolog (rps27a.S)
  • 0610006J14Rik
  • CEP80
  • CG5271
  • Dmel\\CG5271
  • DUb80
  • Dub80
  • hm:zeh0386
  • ik:tdsubc_1f2
  • l(2)04820
  • l(2)31Ei
  • mfs(2)31
  • mfs(2)48
  • mfs48
  • rps27a
  • rps27a.L
  • S27A
  • tdsubc_1f2
  • UB3-D
  • Uba52
  • UBA80
  • Ubb
  • Ubc
  • UBC
  • UBCEP1
  • UBCEP80
  • Ubi-f80
  • Ubi-m
  • Ubiq
  • Ubiz
  • xx:tdsubc_1f2
  • zgc:66168

Gene-IDs for different species

GENE IDSPECIES
6233 Homo sapiens
78294 Mus musculus
395796 Gallus gallus
286839 Bos taurus
34420 Drosophila melanogaster
100286787 Cavia porcellus
337810 Danio rerio
100912032 Rattus norvegicus
105381543 Plutella xylostella
444494 Xenopus laevis
100135694 Ovis aries musimon

Protein level used designations for RPS27A

  • 40S ribosomal protein S27a
  • ubiquitin C
  • ubiquitin and ribosomal protein S27a
  • ubiquitin carboxyl extension protein 80
  • ubiquitin-40S ribosomal protein S27a
  • ubiquitin-CEP80
  • ubiquitin/ribosomal protein
  • CG5271-PA
  • RpS27A-PA
  • Ubiquitin-monomeric
  • male female sterile 31
  • ribosomal protein S27A
  • ubiquitin
  • ubiquitin fusion 80
  • ubiquitin extention protein
  • Ubiquitin carboxyl extension protein 80
  • Ribosomal protein S27A
  • ribosome biogenesis protein NSA2 homolog
  • ubiquitin ribosomal protein RpS27a
  • ribosomal protein S27a L homeolog
  • ribosomal protein S27a S homeolog
  • ubq-S27a protein
Other products related to RPS27A such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com