RUNX1T1 (Runt-Related Transcription Factor 1, Translocated To, 1 (Cyclin D-Related), RUNX1T1)

Short Description: This gene encodes a member of the myeloid translocation gene family which interact with DNA-bound transcription factors and recruit a range of corepressors to facilitate transcriptional repression. The t(8\;21)(q22\;q22) translocation is one of the most frequent karyotypic abnormalities in acute myeloid leukemia. The translocation produces a chimeric gene made up of the 5'-region of the runt-related transcription factor 1 gene fused to the 3'-region of this gene. The chimeric protein is thought to associate with the nuclear corepressor/histone deacetylase complex to block hematopoietic differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2010].
More information related to gene RUNX1T1.
Products related to RUNX1T1 Gene:
Type
  • 156
  • 2
Species
  • 83
  • 44
  • 23
  • 4
  • 2
Application
  • 101
  • 38
  • 20
  • 16
Fusion tag
  • 48
  • 32
  • 29
  • 12
  • 8
Vector Backbone
  • 21
  • 15
  • 11
  • 11
  • 8
Vector
  • 68
  • 45
  • 16
  • 16
  • 9
Insert
  • 65
  • 57
  • 18
  • 8
  • 6
Oligo-Type
  • 2
Resistance Gene
  • 62
  • 56
  • 32
  • 6
  • 2
Expression Type
  • 142
  • 70
Selectable Marker
  • 57
  • 26
Promoter
  • 75
  • 28
  • 19
  • 15
  • 8
Format
  • 84
  • 36
  • 22
  • 16
158 Products

Type:
ORF
Application:
Cloning
Gene:
Runt-Related Transcription Factor 1, Translocated To, 1 (Cyclin D-Related) (RUNX1T1)
Species:
Human
Synonyms:
runx1t1, runx1t1.L, RUNX1T1, Runx1t1
Insert length:
1704 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5757467
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Runt-Related Transcription Factor 1, Translocated To, 1 (Cyclin D-Related) (RUNX1T1)
NCBI Accession:
NM_001198634,NP_001185563
Species:
Human
Synonyms:
runx1t1, runx1t1.L, RUNX1T1, Runx1t1
Insert length:
1848 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5456989
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Runt-Related Transcription Factor 1, Translocated To, 1 (Cyclin D-Related) (RUNX1T1)
Gene ID:
767809 (Zebrafish (Danio rerio), RUNX1T1)
Synonyms:
runx1t1, runx1t1.L, RUNX1T1, Runx1t1
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4069056
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Runt-Related Transcription Factor 1, Translocated To, 1 (Cyclin D-Related) (RUNX1T1)
Gene ID:
733153 (Xenopus laevis, RUNX1T1)
Synonyms:
runx1t1, runx1t1.L, RUNX1T1, Runx1t1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4024738
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Runt-Related Transcription Factor 1, Translocated To, 1 (Cyclin D-Related) (RUNX1T1)
Gene ID:
733153 (Xenopus laevis, RUNX1T1)
Synonyms:
runx1t1, runx1t1.L, RUNX1T1, Runx1t1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4024739
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Runt-Related Transcription Factor 1, Translocated To, 1 (Cyclin D-Related) (RUNX1T1)
Gene ID:
862 (Human, RUNX1T1)
Synonyms:
runx1t1, runx1t1.L, RUNX1T1, Runx1t1
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4083528
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Runt-Related Transcription Factor 1, Translocated To, 1 (Cyclin D-Related) (RUNX1T1)
Gene ID:
862 (Human, RUNX1T1)
Synonyms:
runx1t1, runx1t1.L, RUNX1T1, Runx1t1
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4083531
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Runt-Related Transcription Factor 1, Translocated To, 1 (Cyclin D-Related) (RUNX1T1)
Gene ID:
538628 (Cow, RUNX1T1)
Synonyms:
runx1t1, runx1t1.L, RUNX1T1, Runx1t1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3863414
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Runt-Related Transcription Factor 1, Translocated To, 1 (Cyclin D-Related) (RUNX1T1)
Gene ID:
12395 (Mouse, RUNX1T1)
Synonyms:
runx1t1, runx1t1.L, RUNX1T1, Runx1t1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4001843
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Runt-Related Transcription Factor 1, Translocated To, 1 (Cyclin D-Related) (RUNX1T1)
Gene ID:
12395 (Mouse, RUNX1T1)
Synonyms:
runx1t1, runx1t1.L, RUNX1T1, Runx1t1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4001842
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Runt-Related Transcription Factor 1, Translocated To, 1 (Cyclin D-Related) (RUNX1T1)
Gene ID:
767809 (Zebrafish (Danio rerio), RUNX1T1)
Synonyms:
runx1t1, runx1t1.L, RUNX1T1, Runx1t1
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4069057
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Runt-Related Transcription Factor 1, Translocated To, 1 (Cyclin D-Related) (RUNX1T1)
Gene ID:
733153 (Xenopus laevis, RUNX1T1)
Synonyms:
runx1t1, runx1t1.L, RUNX1T1, Runx1t1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4024736
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Runt-Related Transcription Factor 1, Translocated To, 1 (Cyclin D-Related) (RUNX1T1)
Gene ID:
733153 (Xenopus laevis, RUNX1T1)
Synonyms:
runx1t1, runx1t1.L, RUNX1T1, Runx1t1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4024737
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Runt-Related Transcription Factor 1, Translocated To, 1 (Cyclin D-Related) (RUNX1T1)
Gene ID:
862 (Human, RUNX1T1)
Synonyms:
runx1t1, runx1t1.L, RUNX1T1, Runx1t1
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4083529
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Runt-Related Transcription Factor 1, Translocated To, 1 (Cyclin D-Related) (RUNX1T1)
Gene ID:
862 (Human, RUNX1T1)
Synonyms:
runx1t1, runx1t1.L, RUNX1T1, Runx1t1
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4083530
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Runt-Related Transcription Factor 1, Translocated To, 1 (Cyclin D-Related) (RUNX1T1)
Gene ID:
538628 (Cow, RUNX1T1)
Synonyms:
runx1t1, runx1t1.L, RUNX1T1, Runx1t1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3863415
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Runt-Related Transcription Factor 1, Translocated To, 1 (Cyclin D-Related) (RUNX1T1)
Gene ID:
12395 (Mouse, RUNX1T1)
Synonyms:
runx1t1, runx1t1.L, RUNX1T1, Runx1t1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4001841
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Runt-Related Transcription Factor 1, Translocated To, 1 (Cyclin D-Related) (RUNX1T1)
Gene ID:
12395 (Mouse, RUNX1T1)
Synonyms:
runx1t1, runx1t1.L, RUNX1T1, Runx1t1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4001840
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Runt-Related Transcription Factor 1, Translocated To, 1 (Cyclin D-Related) (RUNX1T1)
Gene ID:
862 (Human, RUNX1T1)
Synonyms:
runx1t1, runx1t1.L, RUNX1T1, Runx1t1
Insert length:
1704 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5318482
$199.17
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Runt-Related Transcription Factor 1, Translocated To, 1 (Cyclin D-Related) (RUNX1T1)
Gene ID:
12395 (Mouse, RUNX1T1)
Synonyms:
runx1t1, runx1t1.L, RUNX1T1, Runx1t1
Vector type:
Mammalian Expression Vector
Vector backbone:
pTCN
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • 3-1291
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4098113
$258.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to RUNX1T1

  • runt-related transcription factor 1; translocated to, 1 (cyclin D-related) (runx1t1)
  • RUNX1 translocation partner 1 L homeolog (runx1t1.L)
  • RUNX1 translocation partner 1 (RUNX1T1)
  • runt-related transcription factor 1; translocated to, 1 (cyclin D-related) (Runx1t1)
  • RUNX1 translocation partner 1 (Runx1t1)
  • AML1T1
  • CBFA2T1
  • Cbfa2t1
  • Cbfa2t1h
  • CDR
  • ETO
  • MTG8
  • si:ch211-232j17.1
  • wu:fi14b07
  • zgc:154044
  • ZMYND2

Gene-IDs for different species

GENE IDSPECIES
767809 Danio rerio
733153 Xenopus laevis
395503 Gallus gallus
862 Homo sapiens
487044 Canis lupus familiaris
12395 Mus musculus
362489 Rattus norvegicus
100155449 Sus scrofa

Protein level used designations for RUNX1T1

  • protein CBFA2T1
  • MTG8
  • MTG8/ETOb
  • expressed during postmitotic spinal neurons, most likely in motorneurons
  • acute myelogenous leukemia 1 translocation 1, cyclin-D related
  • core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related
  • eight twenty one protein
  • myeloid translocation gene on 8q22
  • zinc finger MYND domain-containing protein 2
  • CBFA2T1 identified gene homolog
  • acute myelogenous leukemia 1 translocation 1 protein
  • core-binding factor, runt domain, alpha subunit 2
  • cyclin D-related
  • translocated to, 1
Other products related to RUNX1T1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com