RUNX1T1 (Runt-Related Transcription Factor 1, Translocated To, 1 (Cyclin D-Related), RUNX1T1)

Short Description: This gene encodes a member of the myeloid translocation gene family which interact with DNA-bound transcription factors and recruit a range of corepressors to facilitate transcriptional repression. The t(8\;21)(q22\;q22) translocation is one of the most frequent karyotypic abnormalities in acute myeloid leukemia. The translocation produces a chimeric gene made up of the 5'-region of the runt-related transcription factor 1 gene fused to the 3'-region of this gene. The chimeric protein is thought to associate with the nuclear corepressor/histone deacetylase complex to block hematopoietic differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2010].
More information related to gene RUNX1T1.
Products related to RUNX1T1 Gene:
169 Products
  • 167
  • 2
  • 84
  • 54
  • 23
  • 4
  • 2
  • 105
  • 43
  • 22
  • 16
Fusion tag
  • 49
  • 34
  • 29
  • 15
  • 8
Vector Backbone
  • 21
  • 15
  • 11
  • 11
  • 8
  • 74
  • 45
  • 20
  • 17
  • 9
  • 66
  • 65
  • 20
  • 8
  • 6
  • 2
Resistance Gene
  • 66
  • 62
  • 32
  • 7
  • 2
Expression Type
  • 153
  • 76
Selectable Marker
  • 63
  • 26
  • 81
  • 30
  • 23
  • 15
  • 8
  • 86
  • 45
  • 22
  • 16

Runt-Related Transcription Factor 1, Translocated To, 1 (Cyclin D-Related) (RUNX1T1)
runx1t1, runx1t1.L, RUNX1T1, Runx1t1
Insert length:
1704 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5757467
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Protein Expression
Runt-Related Transcription Factor 1, Translocated To, 1 (Cyclin D-Related) (RUNX1T1)
NCBI Accession:
runx1t1, runx1t1.L, RUNX1T1, Runx1t1
Insert length:
1848 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5456989
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Protein Expression, Cloning
Runt-Related Transcription Factor 1, Translocated To, 1 (Cyclin D-Related) (RUNX1T1)
Gene ID:
767809 (Zebrafish (Danio rerio), RUNX1T1)
runx1t1, runx1t1.L, RUNX1T1, Runx1t1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4069056
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Runt-Related Transcription Factor 1, Translocated To, 1 (Cyclin D-Related) (RUNX1T1)
Gene ID:
12395 (Mouse (Murine), RUNX1T1)
runx1t1, runx1t1.L, RUNX1T1, Runx1t1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter
Stable, Transient

Sequencing Primer:
  • 3-1291
Glycerol Stock
-80 °C
Catalog No. ABIN4098113
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Runt-Related Transcription Factor 1, Translocated To, 1 (Cyclin D-Related) (RUNX1T1)
Gene ID:
862 (Human, RUNX1T1)
runx1t1, runx1t1.L, RUNX1T1, Runx1t1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4083528
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Runt-Related Transcription Factor 1, Translocated To, 1 (Cyclin D-Related) (RUNX1T1)
Gene ID:
862 (Human, RUNX1T1)
runx1t1, runx1t1.L, RUNX1T1, Runx1t1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4083531
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Runt-Related Transcription Factor 1, Translocated To, 1 (Cyclin D-Related) (RUNX1T1)
Gene ID:
538628 (Cow (Bovine), RUNX1T1)
runx1t1, runx1t1.L, RUNX1T1, Runx1t1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3863414
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Runt-Related Transcription Factor 1, Translocated To, 1 (Cyclin D-Related) (RUNX1T1)
Gene ID:
12395 (Mouse (Murine), RUNX1T1)
runx1t1, runx1t1.L, RUNX1T1, Runx1t1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4001843
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Runt-Related Transcription Factor 1, Translocated To, 1 (Cyclin D-Related) (RUNX1T1)
Gene ID:
12395 (Mouse (Murine), RUNX1T1)
runx1t1, runx1t1.L, RUNX1T1, Runx1t1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4001842
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Runt-Related Transcription Factor 1, Translocated To, 1 (Cyclin D-Related) (RUNX1T1)
Gene ID:
733153 (Xenopus laevis, RUNX1T1)
runx1t1, runx1t1.L, RUNX1T1, Runx1t1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4024738
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Runt-Related Transcription Factor 1, Translocated To, 1 (Cyclin D-Related) (RUNX1T1)
Gene ID:
733153 (Xenopus laevis, RUNX1T1)
runx1t1, runx1t1.L, RUNX1T1, Runx1t1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4024739
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Runt-Related Transcription Factor 1, Translocated To, 1 (Cyclin D-Related) (RUNX1T1)
Gene ID:
767809 (Zebrafish (Danio rerio), RUNX1T1)
runx1t1, runx1t1.L, RUNX1T1, Runx1t1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4069057
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Runt-Related Transcription Factor 1, Translocated To, 1 (Cyclin D-Related) (RUNX1T1)
Gene ID:
862 (Human, RUNX1T1)
runx1t1, runx1t1.L, RUNX1T1, Runx1t1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4083530
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Runt-Related Transcription Factor 1, Translocated To, 1 (Cyclin D-Related) (RUNX1T1)
Gene ID:
862 (Human, RUNX1T1)
runx1t1, runx1t1.L, RUNX1T1, Runx1t1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4083529
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Runt-Related Transcription Factor 1, Translocated To, 1 (Cyclin D-Related) (RUNX1T1)
Gene ID:
538628 (Cow (Bovine), RUNX1T1)
runx1t1, runx1t1.L, RUNX1T1, Runx1t1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3863415
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Runt-Related Transcription Factor 1, Translocated To, 1 (Cyclin D-Related) (RUNX1T1)
Gene ID:
12395 (Mouse (Murine), RUNX1T1)
runx1t1, runx1t1.L, RUNX1T1, Runx1t1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4001841
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Runt-Related Transcription Factor 1, Translocated To, 1 (Cyclin D-Related) (RUNX1T1)
Gene ID:
12395 (Mouse (Murine), RUNX1T1)
runx1t1, runx1t1.L, RUNX1T1, Runx1t1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4001840
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Runt-Related Transcription Factor 1, Translocated To, 1 (Cyclin D-Related) (RUNX1T1)
Gene ID:
733153 (Xenopus laevis, RUNX1T1)
runx1t1, runx1t1.L, RUNX1T1, Runx1t1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4024736
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Runt-Related Transcription Factor 1, Translocated To, 1 (Cyclin D-Related) (RUNX1T1)
Gene ID:
733153 (Xenopus laevis, RUNX1T1)
runx1t1, runx1t1.L, RUNX1T1, Runx1t1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4024737
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Runt-Related Transcription Factor 1, Translocated To, 1 (Cyclin D-Related) (RUNX1T1)
Gene ID:
862 (Human, RUNX1T1)
runx1t1, runx1t1.L, RUNX1T1, Runx1t1
Insert length:
1704 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5318482
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days
  • <
  • 1

Synonyms and alternative names related to RUNX1T1

  • runt-related transcription factor 1; translocated to, 1 (cyclin D-related) (runx1t1)
  • RUNX1 translocation partner 1 L homeolog (runx1t1.L)
  • RUNX1 translocation partner 1 (RUNX1T1)
  • runt-related transcription factor 1; translocated to, 1 (cyclin D-related) (Runx1t1)
  • RUNX1 translocation partner 1 (Runx1t1)
  • AML1T1
  • CBFA2T1
  • Cbfa2t1
  • Cbfa2t1h
  • CDR
  • ETO
  • MTG8
  • si:ch211-232j17.1
  • wu:fi14b07
  • zgc:154044
  • ZMYND2

Gene-IDs for different species

767809 Danio rerio
733153 Xenopus laevis
395503 Gallus gallus
862 Homo sapiens
487044 Canis lupus familiaris
12395 Mus musculus
362489 Rattus norvegicus
100155449 Sus scrofa

Protein level used designations for RUNX1T1

  • protein CBFA2T1
  • MTG8
  • MTG8/ETOb
  • expressed during postmitotic spinal neurons, most likely in motorneurons
  • acute myelogenous leukemia 1 translocation 1, cyclin-D related
  • core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related
  • eight twenty one protein
  • myeloid translocation gene on 8q22
  • zinc finger MYND domain-containing protein 2
  • CBFA2T1 identified gene homolog
  • acute myelogenous leukemia 1 translocation 1 protein
  • core-binding factor, runt domain, alpha subunit 2
  • cyclin D-related
  • translocated to, 1
Other products related to RUNX1T1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website