S100A6 (S100 Calcium Binding Protein A6, S100A6)

Short Description: The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein may function in stimulation of Ca2+-dependent insulin release, stimulation of prolactin secretion, and exocytosis. Chromosomal rearrangements and altered expression of this gene have been implicated in melanoma. [provided by RefSeq, Jul 2008].
More information related to gene S100A6.
Products related to S100A6 Gene:
144 Products
Data Quality
  • 1
  • 137
  • 7
  • 57
  • 44
  • 43
  • 91
  • 29
  • 25
  • 16
  • 3
Fusion tag
  • 47
  • 16
  • 15
  • 10
  • 9
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
  • 68
  • 36
  • 12
  • 9
  • 6
  • 61
  • 39
  • 21
  • 8
  • 6
  • 4
  • 3
Resistance Gene
  • 69
  • 43
  • 20
  • 5
  • 2
Expression Type
  • 91
  • 50
  • 37
Selectable Marker
  • 37
  • 26
  • 24
  • 1
  • 50
  • 31
  • 31
  • 13
  • 8
  • 77
  • 27
  • 22
  • 18

S100 Calcium Binding Protein A6 (S100A6)
S100A6, S100a6, LOC618256
Insert length:
273 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5729088
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Protein Expression
S100 Calcium Binding Protein A6 (S100A6)
NCBI Accession:
S100A6, S100a6, LOC618256
Insert length:
273 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5364359
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Protein Expression, Cloning
S100 Calcium Binding Protein A6 (S100A6)
Gene ID:
6277 (Human, S100A6)
S100A6, S100a6, LOC618256
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3464819
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
S100 Calcium Binding Protein A6 (S100A6)
Gene ID:
85247 (Rat (Rattus), S100A6)
S100A6, S100a6, LOC618256
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3879647
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

S100 Calcium Binding Protein A6 (S100A6)
Gene ID:
6277 (Human, S100A6)
S100A6, S100a6, LOC618256
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4086703
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
S100 Calcium Binding Protein A6 (S100A6)
Gene ID:
20200 (Mouse (Murine), S100A6)
S100A6, S100a6, LOC618256
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4217163
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
S100 Calcium Binding Protein A6 (S100A6)
Gene ID:
20200 (Mouse (Murine), S100A6)
S100A6, S100a6, LOC618256
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4217164
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

S100 Calcium Binding Protein A6 (S100A6)
NCBI Accession:
S100A6, S100a6, LOC618256
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:

Sequencing Primer:
  • M13-47 and RV-M
Catalog No. ABIN3564694
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

S100 Calcium Binding Protein A6 (S100A6)
NCBI Accession:
Rat (Rattus)
S100A6, S100a6, LOC618256
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13(-21)
  • M13 rev
Catalog No. ABIN3564696
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

S100 Calcium Binding Protein A6 (S100A6)
NCBI Accession:
Mouse (Murine)
S100A6, S100a6, LOC618256
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:

Sequencing Primer:
  • M13-47 and RV-M
Catalog No. ABIN3564695
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Quantitative real-time PCR
S100 Calcium Binding Protein A6
S100A6, 2A9, 5B10, CABP, CACY, PRA, CALCYCLIN, Cacy
-20 °C
Catalog No. ABIN3189153
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Quantitative real-time PCR
S100 Calcium Binding Protein A6
Mouse (Murine)
S100A6, 2A9, 5B10, CABP, CACY, PRA, CALCYCLIN, Cacy
-20 °C
Catalog No. ABIN3193812
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Quantitative real-time PCR
S100 Calcium Binding Protein A6
Rat (Rattus)
S100A6, 2A9, 5B10, CABP, CACY, PRA, CALCYCLIN, Cacy
-20 °C
Catalog No. ABIN3196954
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Protein Expression, Cloning
S100 Calcium Binding Protein A6 (S100A6)
Gene ID:
6277 (Human, S100A6)
S100A6, S100a6, LOC618256
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3464820
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
S100 Calcium Binding Protein A6 (S100A6)
Gene ID:
85247 (Rat (Rattus), S100A6)
S100A6, S100a6, LOC618256
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3879645
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

S100 Calcium Binding Protein A6 (S100A6)
Gene ID:
6277 (Human, S100A6)
S100A6, S100a6, LOC618256
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4086704
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
S100 Calcium Binding Protein A6 (S100A6)
Gene ID:
20200 (Mouse (Murine), S100A6)
S100A6, S100a6, LOC618256
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4217165
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
S100 Calcium Binding Protein A6 (S100A6)
Gene ID:
20200 (Mouse (Murine), S100A6)
S100A6, S100a6, LOC618256
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4217168
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

S100 Calcium Binding Protein A6 (S100A6)
Gene ID:
6277 (Human, S100A6)
S100A6, S100a6, LOC618256
Insert length:
273 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5311577
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Protein Expression
S100 Calcium Binding Protein A6 (S100A6)
S100A6, S100a6, LOC618256
Insert length:
273 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
His tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4415670
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to S100A6

  • S100 calcium binding protein A6 (S100A6)
  • S100 calcium binding protein A6 (S100a6)
  • uncharacterized LOC618256 (LOC618256)
  • S100 calcium binding protein A6 (calcyclin) (S100a6)
  • 2A9
  • 5B10
  • CABP
  • CACY
  • Cacy
  • PRA
  • S100A6

Gene-IDs for different species

715169 Macaca mulatta
738116 Pan troglodytes
6277 Homo sapiens
100033887 Equus caballus
85247 Rattus norvegicus
100348755 Oryctolagus cuniculus
733608 Sus scrofa
373951 Gallus gallus
480143 Canis lupus familiaris
618256 Bos taurus
101122915 Ovis aries
101083651 Felis catus
20200 Mus musculus

Protein level used designations for S100A6

  • S100 calcium binding protein A6
  • MLN 4
  • S100 calcium-binding protein A6 (calcyclin)
  • calcyclin
  • growth factor-inducible protein 2A9
  • prolactin receptor-associated protein
  • protein S100-A6
  • S100 calcium-binding protein A6
  • calcium binding protein A6 (calcyclin)
  • lung 10 kDa protein
Other products related to S100A6 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com