S100A6 (S100 Calcium Binding Protein A6, S100A6)

Short Description: The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein may function in stimulation of Ca2+-dependent insulin release, stimulation of prolactin secretion, and exocytosis. Chromosomal rearrangements and altered expression of this gene have been implicated in melanoma. [provided by RefSeq, Jul 2008].
More information related to gene S100A6.
Products related to S100A6 Gene:
144 Products
Data Quality
  • 1
Type
  • 137
  • 7
Species
  • 57
  • 44
  • 43
Application
  • 91
  • 29
  • 25
  • 16
  • 3
Fusion tag
  • 47
  • 16
  • 15
  • 10
  • 9
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 68
  • 36
  • 12
  • 9
  • 6
Insert
  • 61
  • 39
  • 21
  • 8
  • 6
Oligo-Type
  • 4
  • 3
Resistance Gene
  • 69
  • 43
  • 20
  • 5
  • 2
Expression Type
  • 91
  • 50
  • 37
Selectable Marker
  • 37
  • 26
  • 24
  • 1
Promoter
  • 50
  • 31
  • 31
  • 13
  • 8
Format
  • 77
  • 27
  • 22
  • 18

Type:
ORF
Application:
Protein Expression
Gene:
S100 Calcium Binding Protein A6 (S100A6)
NCBI Accession:
NM_014624,NP_055439
Species:
Human
Synonyms:
S100A6, S100a6, LOC618256
Insert length:
273 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5364359
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
S100 Calcium Binding Protein A6 (S100A6)
Gene ID:
6277 (Human, S100A6)
Synonyms:
S100A6, S100a6, LOC618256
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3464819
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
S100 Calcium Binding Protein A6 (S100A6)
Gene ID:
6277 (Human, S100A6)
Synonyms:
S100A6, S100a6, LOC618256
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4086703
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
S100 Calcium Binding Protein A6 (S100A6)
Gene ID:
85247 (Rat (Rattus), S100A6)
Synonyms:
S100A6, S100a6, LOC618256
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3879647
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
S100 Calcium Binding Protein A6 (S100A6)
Gene ID:
20200 (Mouse (Murine), S100A6)
Synonyms:
S100A6, S100a6, LOC618256
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4217163
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
S100 Calcium Binding Protein A6 (S100A6)
Gene ID:
20200 (Mouse (Murine), S100A6)
Synonyms:
S100A6, S100a6, LOC618256
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4217164
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
S100 Calcium Binding Protein A6 (S100A6)
NCBI Accession:
NM_053485
Species:
Rat (Rattus)
Synonyms:
S100A6, S100a6, LOC618256
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3564696
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
S100 Calcium Binding Protein A6 (S100A6)
NCBI Accession:
NM_011313
Species:
Mouse (Murine)
Synonyms:
S100A6, S100a6, LOC618256
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3564695
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
S100 Calcium Binding Protein A6 (S100A6)
NCBI Accession:
NM_014624
Species:
Human
Synonyms:
S100A6, S100a6, LOC618256
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3564694
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
S100 Calcium Binding Protein A6
Species:
Human
Synonyms:
S100A6, 2A9, 5B10, CABP, CACY, PRA, CALCYCLIN, Cacy
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3189153
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
S100 Calcium Binding Protein A6
Species:
Rat (Rattus)
Synonyms:
S100A6, 2A9, 5B10, CABP, CACY, PRA, CALCYCLIN, Cacy
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3196954
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
S100 Calcium Binding Protein A6
Species:
Mouse (Murine)
Synonyms:
S100A6, 2A9, 5B10, CABP, CACY, PRA, CALCYCLIN, Cacy
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3193812
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
ORF
Application:
Cloning
Gene:
S100 Calcium Binding Protein A6 (S100A6)
Species:
Human
Synonyms:
S100A6, S100a6, LOC618256
Insert length:
273 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5729088
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
S100 Calcium Binding Protein A6 (S100A6)
Gene ID:
6277 (Human, S100A6)
Synonyms:
S100A6, S100a6, LOC618256
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3464820
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
S100 Calcium Binding Protein A6 (S100A6)
Gene ID:
6277 (Human, S100A6)
Synonyms:
S100A6, S100a6, LOC618256
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4086704
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
S100 Calcium Binding Protein A6 (S100A6)
Gene ID:
85247 (Rat (Rattus), S100A6)
Synonyms:
S100A6, S100a6, LOC618256
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3879645
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
S100 Calcium Binding Protein A6 (S100A6)
Gene ID:
20200 (Mouse (Murine), S100A6)
Synonyms:
S100A6, S100a6, LOC618256
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4217165
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
S100 Calcium Binding Protein A6 (S100A6)
Gene ID:
20200 (Mouse (Murine), S100A6)
Synonyms:
S100A6, S100a6, LOC618256
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4217168
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
S100 Calcium Binding Protein A6 (S100A6)
Gene ID:
6277 (Human, S100A6)
Synonyms:
S100A6, S100a6, LOC618256
Insert length:
273 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5311577
$184.46
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
S100 Calcium Binding Protein A6 (S100A6)
NCBI Accession:
NM_014624,NP_055439
Species:
Human
Synonyms:
S100A6, S100a6, LOC618256
Insert length:
570 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Tan, Wu, Ren, Wang, Li, Alshenawy, Li, Cui, Luo, Siegel, Fu, Lu: "A Point Mutation in DNA Polymerase β (POLB) Gene Is Associated with Increased Progesterone Receptor (PR) Expression and Intraperitoneal Metastasis in Gastric Cancer." in: Journal of Cancer, Vol. 7, Issue 11, pp. 1472-80, 2016 (Pubmed)
Catalog No. ABIN3386570
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to S100A6

  • S100 calcium binding protein A6 (S100A6)
  • S100 calcium binding protein A6 (S100a6)
  • uncharacterized LOC618256 (LOC618256)
  • S100 calcium binding protein A6 (calcyclin) (S100a6)
  • 2A9
  • 5B10
  • CABP
  • CACY
  • Cacy
  • CALCYCLIN
  • PRA
  • S100A6

Gene-IDs for different species

GENE IDSPECIES
715169 Macaca mulatta
738116 Pan troglodytes
6277 Homo sapiens
100033887 Equus caballus
85247 Rattus norvegicus
100348755 Oryctolagus cuniculus
733608 Sus scrofa
373951 Gallus gallus
480143 Canis lupus familiaris
618256 Bos taurus
101122915 Ovis aries
101083651 Felis catus
20200 Mus musculus

Protein level used designations for S100A6

  • S100 calcium binding protein A6
  • MLN 4
  • S100 calcium-binding protein A6 (calcyclin)
  • calcyclin
  • growth factor-inducible protein 2A9
  • prolactin receptor-associated protein
  • protein S100-A6
  • S100 calcium-binding protein A6
  • calcium binding protein A6 (calcyclin)
  • lung 10 kDa protein
Other products related to S100A6 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com