s100b (S100 Calcium Binding Protein B, S100B)

Short Description: The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21\; however, this gene is located at 21q22.3. This protein may function in Neurite extension, proliferation of melanoma cells, stimulation of Ca2+ fluxes, inhibition of PKC-mediated phosphorylation, astrocytosis and axonal proliferation, and inhibition of microtubule assembly. Chromosomal rearrangements and altered expression of this gene have been implicated in several neurological, neoplastic, and other types of diseases, including Alzheimer's disease, Down's syndrome, epilepsy, amyotrophic lateral sclerosis, melanoma, and type I diabetes. [provided by RefSeq, Jul 2008].
More information related to gene s100b.
Products related to s100b Gene:
144 Products
Data Quality
  • 2
Type
  • 138
  • 6
Species
  • 55
  • 40
  • 29
  • 14
  • 4
Application
  • 94
  • 29
  • 23
  • 16
  • 2
Fusion tag
  • 47
  • 16
  • 15
  • 10
  • 9
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 4
Vector
  • 71
  • 34
  • 12
  • 9
  • 5
Insert
  • 63
  • 40
  • 19
  • 8
  • 6
Oligo-Type
  • 4
  • 2
Resistance Gene
  • 72
  • 41
  • 20
  • 5
  • 2
Expression Type
  • 90
  • 48
  • 39
Selectable Marker
  • 39
  • 25
  • 24
  • 1
Promoter
  • 51
  • 31
  • 31
  • 13
  • 8
Format
  • 79
  • 27
  • 21
  • 17

Type:
ORF
Application:
Cloning
Gene:
S100 Calcium Binding Protein B (S100B)
Species:
Human
Synonyms:
S100B, S100b, s100b
Insert length:
279 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5729091
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
S100 Calcium Binding Protein B (S100B)
NCBI Accession:
NM_006272,NP_006263
Species:
Human
Synonyms:
S100B, S100b, s100b
Insert length:
279 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5364366
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
S100 Calcium Binding Protein B (S100B)
Gene ID:
525716 (Cow (Bovine), S100B)
Synonyms:
S100B, S100b, s100b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3861047
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
S100 Calcium Binding Protein B (S100B)
Gene ID:
525716 (Cow (Bovine), S100B)
Synonyms:
S100B, S100b, s100b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3861051
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
S100 Calcium Binding Protein B (S100B)
Gene ID:
25742 (Rat (Rattus), S100B)
Synonyms:
S100B, S100b, s100b
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4046026
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
S100 Calcium Binding Protein B (S100B)
Gene ID:
6285 (Human, S100B)
Synonyms:
S100B, S100b, s100b
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4086711
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
S100 Calcium Binding Protein B (S100B)
NCBI Accession:
NM_001082730
Species:
Rabbit
Synonyms:
S100B, S100b, s100b
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3564702
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
S100 Calcium Binding Protein B (S100B)
NCBI Accession:
NM_006272
Species:
Human
Synonyms:
S100B, S100b, s100b
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3564703
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
S100 Calcium Binding Protein B (S100B)
NCBI Accession:
NM_009115
Species:
Mouse (Murine)
Synonyms:
S100B, S100b, s100b
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3564701
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
S100 Calcium Binding Protein B
Species:
Human
Synonyms:
NEF, S100, S100-B, S100beta, S100P, AI850290, Bpb, si:dkey-110p14.2, wu:fq18b10, zgc:92776
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3188584
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
S100 Calcium Binding Protein B
Species:
Mouse (Murine)
Synonyms:
NEF, S100, S100-B, S100beta, S100P, AI850290, Bpb, si:dkey-110p14.2, wu:fq18b10, zgc:92776
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3194508
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
S100 Calcium Binding Protein B (S100B)
Gene ID:
525716 (Cow (Bovine), S100B)
Synonyms:
S100B, S100b, s100b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3861048
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
S100 Calcium Binding Protein B (S100B)
Gene ID:
525716 (Cow (Bovine), S100B)
Synonyms:
S100B, S100b, s100b
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3861052
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
S100 Calcium Binding Protein B (S100B)
Gene ID:
25742 (Rat (Rattus), S100B)
Synonyms:
S100B, S100b, s100b
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4046025
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
S100 Calcium Binding Protein B (S100B)
Gene ID:
6285 (Human, S100B)
Synonyms:
S100B, S100b, s100b
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4086712
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
S100 Calcium Binding Protein B (S100B)
Gene ID:
6285 (Human, S100B)
Synonyms:
S100B, S100b, s100b
Insert length:
279 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5318139
$179.56
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
S100 Calcium Binding Protein B (S100B)
Species:
Human
Synonyms:
S100B, S100b, s100b
Insert length:
279 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4415673
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
S100 Calcium Binding Protein B (S100B)
Species:
Human
Synonyms:
S100B, S100b, s100b
Insert length:
279 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4480759
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
S100 Calcium Binding Protein B (S100B)
Species:
Human
Synonyms:
S100B, S100b, s100b
Insert length:
279 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4624230
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
S100 Calcium Binding Protein B (S100B)
Species:
Human
Synonyms:
S100B, S100b, s100b
Insert length:
279 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4710435
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to s100b

  • S100 calcium binding protein B (S100B)
  • S100 calcium binding protein B (S100b)
  • S100 protein, beta polypeptide, neural (S100b)
  • S100 calcium binding protein, beta (neural) (s100b)
  • AI850290
  • Bpb
  • NEF
  • S100
  • S100-B
  • S100beta
  • S100P
  • si:dkey-110p14.2
  • wu:fq18b10
  • zgc:92776

Gene-IDs for different species

GENE IDSPECIES
6285 Homo sapiens
25742 Rattus norvegicus
20203 Mus musculus
525716 Bos taurus
424038 Gallus gallus
100009495 Oryctolagus cuniculus
491615 Canis lupus familiaris
101099488 Felis catus
100533204 Sus scrofa
100726901 Cavia porcellus
101113190 Ovis aries
436825 Danio rerio

Protein level used designations for s100b

  • S-100 calcium-binding protein, beta chain
  • S-100 protein subunit beta
  • S100 calcium-binding protein, beta (neural)
  • protein S100-B
  • S-100 protein beta chain
  • S100 calcium-binding protein B
  • S100 calcium-binding protein beta (neural)
  • S100 protein, beta polypeptide, neural
  • S100 protein, beta polypeptide
  • S100 calcium binding protein, beta (neural)
  • S100 calcium-binding protein, beta
  • S-100 calcium-binding protein beta subunit
Other products related to s100b such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com