SAYSD1 (SAYSVFN Motif Domain Containing 1, SAYSD1)

Products related to SAYSD1 Gene:
74 Products
Type
  • 73
  • 1
Species
  • 42
  • 30
  • 2
Application
  • 47
  • 14
  • 12
  • 11
Fusion tag
  • 27
  • 11
  • 8
  • 7
  • 4
Vector Backbone
  • 5
  • 5
  • 4
  • 4
  • 3
Vector
  • 28
  • 23
  • 6
  • 6
  • 5
Insert
  • 31
  • 20
  • 10
  • 6
  • 4
Oligo-Type
  • 1
Resistance Gene
  • 30
  • 24
  • 14
  • 5
  • 2
Expression Type
  • 54
  • 29
  • 11
Selectable Marker
  • 16
  • 14
  • 11
  • 1
Promoter
  • 22
  • 20
  • 19
  • 7
  • 6
Format
  • 35
  • 15
  • 14
  • 10

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
SAYSVFN Motif Domain Containing 1 (SAYSD1)
Gene ID:
618888 (Cow (Bovine), SAYSD1)
Synonyms:
SAYSD1, Saysd1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3867993
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
SAYSVFN Motif Domain Containing 1 (SAYSD1)
Gene ID:
55776 (Human, SAYSD1)
Synonyms:
SAYSD1, Saysd1
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3469788
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
SAYSVFN Motif Domain Containing 1 (SAYSD1)
NCBI Accession:
NM_026209
Species:
Mouse (Murine)
Synonyms:
SAYSD1, Saysd1
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3564739
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
ORF
Application:
Cloning
Gene:
SAYSVFN Motif Domain Containing 1 (SAYSD1)
Species:
Human
Synonyms:
SAYSD1, Saysd1
Insert length:
552 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5764277
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
SAYSVFN Motif Domain Containing 1 (SAYSD1)
Gene ID:
618888 (Cow (Bovine), SAYSD1)
Synonyms:
SAYSD1, Saysd1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3867994
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
SAYSVFN Motif Domain Containing 1 (SAYSD1)
Gene ID:
55776 (Human, SAYSD1)
Synonyms:
SAYSD1, Saysd1
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3469789
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
SAYSVFN Motif Domain Containing 1 (SAYSD1)
Gene ID:
55776 (Human, SAYSD1)
Synonyms:
SAYSD1, Saysd1
Insert length:
552 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5318278
$184.46
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
SAYSVFN Motif Domain Containing 1 (SAYSD1)
NCBI Accession:
NM_018322,NP_060792
Species:
Human
Synonyms:
SAYSD1, Saysd1
Insert length:
1880 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3379897
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
SAYSVFN Motif Domain Containing 1 (SAYSD1)
Species:
Human
Synonyms:
SAYSD1, Saysd1
Insert length:
552 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4764971
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
SAYSVFN Motif Domain Containing 1 (SAYSD1)
Species:
Human
Synonyms:
SAYSD1, Saysd1
Insert length:
552 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4759678
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
SAYSVFN Motif Domain Containing 1 (SAYSD1)
Species:
Human
Synonyms:
SAYSD1, Saysd1
Insert length:
552 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4434398
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
SAYSVFN Motif Domain Containing 1 (SAYSD1)
Species:
Human
Synonyms:
SAYSD1, Saysd1
Insert length:
552 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4473303
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
SAYSVFN Motif Domain Containing 1 (SAYSD1)
Gene ID:
55776 (Human, SAYSD1)
Synonyms:
SAYSD1, Saysd1
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3429678
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
SAYSVFN Motif Domain Containing 1 (SAYSD1)
Gene ID:
55776 (Human, SAYSD1)
Synonyms:
SAYSD1, Saysd1
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3396382
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
SAYSVFN Motif Domain Containing 1 (SAYSD1)
Gene ID:
55776 (Human, SAYSD1)
Synonyms:
SAYSD1, Saysd1
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR221
Resistance Gene:
Kanamycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3426987
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
SAYSVFN Motif Domain Containing 1 (SAYSD1)
Gene ID:
55776 (Human, SAYSD1)
Synonyms:
SAYSD1, Saysd1
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR221
Resistance Gene:
Kanamycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3427067
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
SAYSVFN Motif Domain Containing 1 (SAYSD1)
Species:
Mouse (Murine)
Synonyms:
SAYSD1, Saysd1
Insert length:
567 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3307715
$330.00
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
SAYSVFN Motif Domain Containing 1 (SAYSD1)
NCBI Accession:
NM_026209,NP_080485
Species:
Mouse (Murine)
Synonyms:
SAYSD1, Saysd1
Insert length:
567 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3369093
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Application:
RNA Interference
Gene:
SAYSVFN Motif Domain Containing 1
Species:
Mouse (Murine)
Synonyms:
C6orf64, SAYSD1, C23H6orf64, 1810063B07Rik, 4930488P03Rik
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • 1810063B07Rik (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3278645
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
SAYSVFN Motif Domain Containing 1 (SAYSD1)
NCBI Accession:
NM_018322
Species:
Human
Synonyms:
SAYSD1, Saysd1
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of C6orf64
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5165002
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
  • <
  • 1

Synonyms and alternative names related to SAYSD1

  • SAYSVFN motif domain containing 1 (SAYSD1)
  • SAYSVFN motif domain containing 1 (Saysd1)
  • 1810063B07Rik
  • 4930488P03Rik
  • C6orf64
  • C23H6orf64
  • SAYSD1

Gene-IDs for different species

GENE IDSPECIES
421426 Gallus gallus
55776 Homo sapiens
618888 Bos taurus
67509 Mus musculus

Protein level used designations for SAYSD1

  • SAYSVFN motif domain containing 1
  • SAYSvFN domain-containing protein 1
  • uncharacterized protein C6orf64 homolog
Other products related to SAYSD1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com