SAYSD1 (SAYSVFN Motif Domain Containing 1, SAYSD1)

Products related to SAYSD1 Gene:
74 Products
  • 73
  • 1
  • 42
  • 30
  • 2
  • 47
  • 14
  • 12
  • 11
Fusion tag
  • 27
  • 11
  • 8
  • 7
  • 4
Vector Backbone
  • 5
  • 5
  • 4
  • 4
  • 3
  • 28
  • 23
  • 6
  • 6
  • 5
  • 31
  • 20
  • 10
  • 6
  • 4
  • 1
Resistance Gene
  • 30
  • 24
  • 14
  • 5
  • 2
Expression Type
  • 54
  • 29
  • 11
Selectable Marker
  • 16
  • 14
  • 11
  • 1
  • 22
  • 20
  • 19
  • 7
  • 6
  • 35
  • 15
  • 14
  • 10

SAYSVFN Motif Domain Containing 1 (SAYSD1)
SAYSD1, Saysd1
Insert length:
552 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5764277
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

SAYSVFN Motif Domain Containing 1 (SAYSD1)
Gene ID:
55776 (Human, SAYSD1)
SAYSD1, Saysd1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3469788
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
SAYSVFN Motif Domain Containing 1 (SAYSD1)
Gene ID:
618888 (Cow (Bovine), SAYSD1)
SAYSD1, Saysd1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3867993
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

SAYSVFN Motif Domain Containing 1 (SAYSD1)
NCBI Accession:
Mouse (Murine)
SAYSD1, Saysd1
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Catalog No. ABIN3564739
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

SAYSVFN Motif Domain Containing 1 (SAYSD1)
Gene ID:
55776 (Human, SAYSD1)
SAYSD1, Saysd1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3469789
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
SAYSVFN Motif Domain Containing 1 (SAYSD1)
Gene ID:
618888 (Cow (Bovine), SAYSD1)
SAYSD1, Saysd1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3867994
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

SAYSVFN Motif Domain Containing 1 (SAYSD1)
Gene ID:
55776 (Human, SAYSD1)
SAYSD1, Saysd1
Insert length:
552 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
2 μg of lyophilized gene in pDONR223 vector
-20 °C
Catalog No. ABIN5318278
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Protein Expression
SAYSVFN Motif Domain Containing 1 (SAYSD1)
SAYSD1, Saysd1
Insert length:
552 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
His tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4434398
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
SAYSVFN Motif Domain Containing 1 (SAYSD1)
SAYSD1, Saysd1
Insert length:
552 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
HA tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4473303
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

SAYSVFN Motif Domain Containing 1 (SAYSD1)
SAYSD1, Saysd1
Insert length:
552 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4759678
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

SAYSVFN Motif Domain Containing 1 (SAYSD1)
SAYSD1, Saysd1
Insert length:
552 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:
His tag

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4764971
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
SAYSVFN Motif Domain Containing 1 (SAYSD1)
Gene ID:
55776 (Human, SAYSD1)
SAYSD1, Saysd1
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3429678
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression
SAYSVFN Motif Domain Containing 1 (SAYSD1)
Gene ID:
55776 (Human, SAYSD1)
SAYSD1, Saysd1
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3427067
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression
SAYSVFN Motif Domain Containing 1 (SAYSD1)
Gene ID:
55776 (Human, SAYSD1)
SAYSD1, Saysd1
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3426987
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression
SAYSVFN Motif Domain Containing 1 (SAYSD1)
Gene ID:
55776 (Human, SAYSD1)
SAYSD1, Saysd1
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3396382
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression
SAYSVFN Motif Domain Containing 1 (SAYSD1)
NCBI Accession:
SAYSD1, Saysd1
Insert length:
1880 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3379897
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Protein Expression
SAYSVFN Motif Domain Containing 1 (SAYSD1)
Mouse (Murine)
SAYSD1, Saysd1
Insert length:
567 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3307715
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Protein Expression
SAYSVFN Motif Domain Containing 1 (SAYSD1)
NCBI Accession:
Mouse (Murine)
SAYSD1, Saysd1
Insert length:
567 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
Enhanced CMV Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3369093
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Genome Editing with Engineered Nucleases, Protein Expression
SAYSVFN Motif Domain Containing 1 (SAYSD1)
NCBI Accession:
SAYSD1, Saysd1
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of C6orf64
Viral Particles
-80 °C
Catalog No. ABIN5165002
300 μL
Plus shipping costs $45.00 and $22.00 dry ice

Genome Editing with Engineered Nucleases, Protein Expression
SAYSVFN Motif Domain Containing 1 (SAYSD1)
NCBI Accession:
Mouse (Murine)
SAYSD1, Saysd1
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of 1810063B07Rik
Viral Particles
-80 °C
Catalog No. ABIN5165004
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
  • <
  • 1

Synonyms and alternative names related to SAYSD1

  • SAYSVFN motif domain containing 1 (SAYSD1)
  • SAYSVFN motif domain containing 1 (Saysd1)
  • 1810063B07Rik
  • 4930488P03Rik
  • C6orf64
  • C23H6orf64
  • SAYSD1

Gene-IDs for different species

421426 Gallus gallus
55776 Homo sapiens
618888 Bos taurus
67509 Mus musculus

Protein level used designations for SAYSD1

  • SAYSVFN motif domain containing 1
  • SAYSvFN domain-containing protein 1
  • uncharacterized protein C6orf64 homolog
Other products related to SAYSD1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website