SCAI (Suppressor of Cancer Cell Invasion, SCAI)

Short Description: This gene encodes a regulator of cell migration. The encoded protein appears to function in the RhoA (ras homolog gene family, member A)-Dia1 (diaphanous homolog 1) signal transduction pathway. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010].
More information related to gene SCAI.
Products related to SCAI Gene:
79 Products
Type
  • 77
  • 2
Species
  • 50
  • 29
Application
  • 45
  • 16
  • 16
  • 14
Fusion tag
  • 29
  • 13
  • 9
  • 6
  • 5
Vector Backbone
  • 6
  • 6
  • 6
  • 5
  • 5
Vector
  • 30
  • 27
  • 10
  • 6
  • 4
Insert
  • 28
  • 19
  • 14
  • 8
  • 6
Oligo-Type
  • 2
Resistance Gene
  • 32
  • 30
  • 14
  • 2
  • 1
Expression Type
  • 57
  • 36
  • 11
Selectable Marker
  • 20
  • 20
  • 11
  • 6
Promoter
  • 26
  • 22
  • 15
  • 8
  • 6
Format
  • 40
  • 19
  • 11
  • 9
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Suppressor of Cancer Cell Invasion (SCAI)
Gene ID:
320271 (Mouse (Murine), SCAI)
Synonyms:
SCAI, scai, Scai, LOC100557403
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4016495
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Suppressor of Cancer Cell Invasion (SCAI)
Gene ID:
286205 (Human, SCAI)
Synonyms:
SCAI, scai, Scai, LOC100557403
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3994933
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Suppressor of Cancer Cell Invasion (SCAI)
Gene ID:
286205 (Human, SCAI)
Synonyms:
SCAI, scai, Scai, LOC100557403
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3994932
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Suppressor of Cancer Cell Invasion (SCAI)
Gene ID:
286205 (Human, SCAI)
Synonyms:
SCAI, scai, Scai, LOC100557403
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3994934
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Suppressor of Cancer Cell Invasion (SCAI)
NCBI Accession:
NM_001144877
Species:
Human
Synonyms:
SCAI, scai, Scai, LOC100557403
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3564748
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Suppressor of Cancer Cell Invasion (SCAI)
Gene ID:
286205 (Human, SCAI)
Synonyms:
SCAI, scai, Scai, LOC100557403
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3994935
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Suppressor of Cancer Cell Invasion (SCAI)
Gene ID:
286205 (Human, SCAI)
Synonyms:
SCAI, scai, Scai, LOC100557403
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3994936
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Suppressor of Cancer Cell Invasion (SCAI)
Gene ID:
286205 (Human, SCAI)
Synonyms:
SCAI, scai, Scai, LOC100557403
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3994937
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Suppressor of Cancer Cell Invasion (SCAI)
Gene ID:
320271 (Mouse (Murine), SCAI)
Synonyms:
SCAI, scai, Scai, LOC100557403
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4016494
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Suppressor of Cancer Cell Invasion (SCAI)
NCBI Accession:
NM_173690,NP_775961
Species:
Human
Synonyms:
SCAI, scai, Scai, LOC100557403
Insert length:
1890 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5474869
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
Supplier: Log in to see

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Suppressor of Cancer Cell Invasion (SCAI)
NCBI Accession:
NM_001144877
Species:
Human
Synonyms:
SCAI, scai, Scai, LOC100557403
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of C9orf126
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5162936
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Suppressor of Cancer Cell Invasion (SCAI)
NCBI Accession:
NM_001144877
Species:
Human
Synonyms:
SCAI, scai, Scai, LOC100557403
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of SCAI
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5162938
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Suppressor of Cancer Cell Invasion (SCAI)
NCBI Accession:
NM_178778
Species:
Mouse (Murine)
Synonyms:
SCAI, scai, Scai, LOC100557403
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Scai
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5162940
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Application:
RNA Interference
Gene:
Suppressor of Cancer Cell Invasion
Species:
Human
Synonyms:
C9orf126, NET40, 9330112M16, A930041I02Rik, AI662729
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • SCAI (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3314298
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Application:
RNA Interference
Gene:
Suppressor of Cancer Cell Invasion
Species:
Mouse (Murine)
Synonyms:
C9orf126, NET40, 9330112M16, A930041I02Rik, AI662729
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • A930041I02Rik (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3265617
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Cloning
Gene:
Suppressor of Cancer Cell Invasion (SCAI)
NCBI Accession:
NM_178778
Species:
Mouse (Murine)
Synonyms:
SCAI, scai, Scai, LOC100557403
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5763303
$475.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
Supplier: Log in to see

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Suppressor of Cancer Cell Invasion (SCAI)
Gene ID:
286205 (Human, SCAI)
Synonyms:
SCAI, scai, Scai, LOC100557403
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter, U6 Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Viral particles:
ABIN5053774

Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5034829
$503.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days
Supplier: Log in to see

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Suppressor of Cancer Cell Invasion (SCAI)
NCBI Accession:
NM_001144877
Species:
Human
Synonyms:
SCAI, scai, Scai, LOC100557403
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of C9orf126
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5278521
$520.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Suppressor of Cancer Cell Invasion (SCAI)
NCBI Accession:
NM_001144877
Species:
Human
Synonyms:
SCAI, scai, Scai, LOC100557403
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of SCAI
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5278523
$520.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
Supplier: Log in to see

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Suppressor of Cancer Cell Invasion (SCAI)
NCBI Accession:
NM_178778
Species:
Mouse (Murine)
Synonyms:
SCAI, scai, Scai, LOC100557403
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Scai
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5278525
$520.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
  • <
  • 1

Synonyms and alternative names related to SCAI

  • suppressor of cancer cell invasion (SCAI)
  • suppressor of cancer cell invasion (scai)
  • suppressor of cancer cell invasion (Scai)
  • protein SCAI (LOC100557403)
  • 9330112M16
  • A930041I02Rik
  • AI662729
  • C9orf126
  • NET40

Gene-IDs for different species

GENE IDSPECIES
473107 Pan troglodytes
556383 Danio rerio
612887 Canis lupus familiaris
690538 Rattus norvegicus
100463978 Ailuropoda melanoleuca
100515704 Sus scrofa
100538393 Meleagris gallopavo
100557403 Anolis carolinensis
100595391 Nomascus leucogenys
286205 Homo sapiens
320271 Mus musculus

Protein level used designations for SCAI

  • suppressor of cancer cell invasion
  • protein SCAI
  • suppressor of cancer cell invasion protein
Other products related to SCAI such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com