SDF2L1 (Stromal Cell Derived Factor 2-Like 1, SDF2L1)

Products related to SDF2L1 Gene:
114 Products
  • 112
  • 2
  • 49
  • 29
  • 26
  • 4
  • 2
  • 68
  • 32
  • 22
  • 16
Fusion tag
  • 43
  • 15
  • 11
  • 10
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
  • 46
  • 35
  • 12
  • 9
  • 8
  • 44
  • 32
  • 20
  • 8
  • 6
  • 2
Resistance Gene
  • 46
  • 43
  • 18
  • 5
  • 2
Expression Type
  • 94
  • 48
  • 11
Selectable Marker
  • 28
  • 26
  • 11
  • 30
  • 30
  • 28
  • 13
  • 8
  • 43
  • 27
  • 22
  • 22

Protein Expression
Stromal Cell Derived Factor 2-Like 1 (SDF2L1)
NCBI Accession:
SDF2L1, Sdf2l1
Insert length:
666 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5463483
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Protein Expression, Cloning
Stromal Cell Derived Factor 2-Like 1 (SDF2L1)
Gene ID:
445275 (Zebrafish (Danio rerio), SDF2L1)
SDF2L1, Sdf2l1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4058245
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Stromal Cell Derived Factor 2-Like 1 (SDF2L1)
Gene ID:
445275 (Zebrafish (Danio rerio), SDF2L1)
SDF2L1, Sdf2l1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4058246
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Stromal Cell Derived Factor 2-Like 1 (SDF2L1)
Gene ID:
517962 (Cow (Bovine), SDF2L1)
SDF2L1, Sdf2l1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3860013
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Stromal Cell Derived Factor 2-Like 1 (SDF2L1)
Gene ID:
64136 (Mouse (Murine), SDF2L1)
SDF2L1, Sdf2l1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3875960
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Stromal Cell Derived Factor 2-Like 1 (SDF2L1)
Gene ID:
496057 (Xenopus laevis, SDF2L1)
SDF2L1, Sdf2l1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4059588
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Stromal Cell Derived Factor 2-Like 1 (SDF2L1)
Gene ID:
23753 (Human, SDF2L1)
SDF2L1, Sdf2l1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4004414
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Stromal Cell Derived Factor 2-Like 1 (SDF2L1)
Gene ID:
23753 (Human, SDF2L1)
SDF2L1, Sdf2l1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4004415
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Stromal Cell Derived Factor 2-Like 1 (SDF2L1)
Gene ID:
493395 (Xenopus tropicalis, SDF2L1)
SDF2L1, Sdf2l1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3885919
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Stromal Cell Derived Factor 2-Like 1 (SDF2L1)
NCBI Accession:
SDF2L1, Sdf2l1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13(-21)
  • M13 rev
Catalog No. ABIN3564798
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Protein Expression, Cloning
Stromal Cell Derived Factor 2-Like 1 (SDF2L1)
Gene ID:
445275 (Zebrafish (Danio rerio), SDF2L1)
SDF2L1, Sdf2l1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4058244
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Stromal Cell Derived Factor 2-Like 1 (SDF2L1)
Gene ID:
445275 (Zebrafish (Danio rerio), SDF2L1)
SDF2L1, Sdf2l1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4058247
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Stromal Cell Derived Factor 2-Like 1 (SDF2L1)
SDF2L1, Sdf2l1
Insert length:
666 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5759656
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Protein Expression, Cloning
Stromal Cell Derived Factor 2-Like 1 (SDF2L1)
Gene ID:
64136 (Mouse (Murine), SDF2L1)
SDF2L1, Sdf2l1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3819034
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Stromal Cell Derived Factor 2-Like 1 (SDF2L1)
Gene ID:
517962 (Cow (Bovine), SDF2L1)
SDF2L1, Sdf2l1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3860012
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Stromal Cell Derived Factor 2-Like 1 (SDF2L1)
Gene ID:
493395 (Xenopus tropicalis, SDF2L1)
SDF2L1, Sdf2l1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3885918
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Stromal Cell Derived Factor 2-Like 1 (SDF2L1)
Gene ID:
496057 (Xenopus laevis, SDF2L1)
SDF2L1, Sdf2l1
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4059589
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Stromal Cell Derived Factor 2-Like 1 (SDF2L1)
Gene ID:
23753 (Human, SDF2L1)
SDF2L1, Sdf2l1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4004412
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Stromal Cell Derived Factor 2-Like 1 (SDF2L1)
Gene ID:
23753 (Human, SDF2L1)
SDF2L1, Sdf2l1
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:
Selection Marker:

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4004413
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression
Stromal Cell Derived Factor 2-Like 1 (SDF2L1)
NCBI Accession:
SDF2L1, Sdf2l1
Insert length:
910 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter, T7 Promoter

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
RT,-20 °C
Catalog No. ABIN3386621
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to SDF2L1

  • stromal cell derived factor 2 like 1 (SDF2L1)
  • stromal cell-derived factor 2-like 1 (Sdf2l1)

Gene-IDs for different species

23753 Homo sapiens
64136 Mus musculus
680945 Rattus norvegicus
517962 Bos taurus
416770 Gallus gallus
101115992 Ovis aries

Protein level used designations for SDF2L1

  • OTTHUMT00000075032
  • PWP1-interacting protein 8
  • SDF2-like 1
  • SDF2-like protein 1
  • dihydropyrimidinase-like 2
  • stromal cell-derived factor 2-like protein 1
Other products related to SDF2L1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website