SGK2 (serum/glucocorticoid Regulated Kinase 2, SGK2)

Short Description: This gene encodes a serine/threonine protein kinase. Although this gene product is similar to serum- and glucocorticoid-induced protein kinase (SGK), this gene is not induced by serum or glucocorticoids. This gene is induced in response to signals that activate phosphatidylinositol 3-kinase, which is also true for SGK. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2010].
More information related to gene SGK2.
Products related to SGK2 Gene:
113 Products
Type
  • 109
  • 4
Species
  • 48
  • 29
  • 26
  • 8
  • 2
Application
  • 66
  • 28
  • 25
  • 16
Fusion tag
  • 44
  • 19
  • 13
  • 9
  • 8
Vector Backbone
  • 8
  • 7
  • 7
  • 6
  • 6
Vector
  • 44
  • 37
  • 12
  • 9
  • 6
Insert
  • 48
  • 24
  • 21
  • 8
  • 6
Oligo-Type
  • 4
Resistance Gene
  • 48
  • 38
  • 22
  • 2
  • 1
Expression Type
  • 102
  • 52
Selectable Marker
  • 34
  • 26
Promoter
  • 38
  • 31
  • 20
  • 16
  • 8
Format
  • 46
  • 24
  • 22
  • 21
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
serum/glucocorticoid Regulated Kinase 2 (SGK2)
Gene ID:
559050 (Zebrafish (Danio rerio), SGK2)
Synonyms:
SGK2, Sgk2, sgk2a, sgk2
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4065896
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
serum/glucocorticoid Regulated Kinase 2 (SGK2)
Gene ID:
570956 (Zebrafish (Danio rerio), SGK2)
Synonyms:
SGK2, Sgk2, sgk2a, sgk2
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4066464
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
serum/glucocorticoid Regulated Kinase 2 (SGK2)
Gene ID:
570956 (Zebrafish (Danio rerio), SGK2)
Synonyms:
SGK2, Sgk2, sgk2a, sgk2
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4023974
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
serum/glucocorticoid Regulated Kinase 2 (SGK2)
Gene ID:
570956 (Zebrafish (Danio rerio), SGK2)
Synonyms:
SGK2, Sgk2, sgk2a, sgk2
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4023975
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
serum/glucocorticoid Regulated Kinase 2 (SGK2)
Gene ID:
10110 (Human, SGK2)
Synonyms:
SGK2, Sgk2, sgk2a, sgk2
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4088644
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
serum/glucocorticoid Regulated Kinase 2 (SGK2)
Gene ID:
517909 (Cow (Bovine), SGK2)
Synonyms:
SGK2, Sgk2, sgk2a, sgk2
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4063212
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
serum/glucocorticoid Regulated Kinase 2 (SGK2)
Gene ID:
27219 (Mouse (Murine), SGK2)
Synonyms:
SGK2, Sgk2, sgk2a, sgk2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3812932
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
serum/glucocorticoid Regulated Kinase 2 (SGK2)
Gene ID:
10110 (Human, SGK2)
Synonyms:
SGK2, Sgk2, sgk2a, sgk2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3466113
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
serum/glucocorticoid Regulated Kinase 2 (SGK2)
Gene ID:
559050 (Zebrafish (Danio rerio), SGK2)
Synonyms:
SGK2, Sgk2, sgk2a, sgk2
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4065895
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
serum/glucocorticoid Regulated Kinase 2 (SGK2)
Gene ID:
570956 (Zebrafish (Danio rerio), SGK2)
Synonyms:
SGK2, Sgk2, sgk2a, sgk2
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4066465
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
serum/glucocorticoid Regulated Kinase 2 (SGK2)
Gene ID:
570956 (Zebrafish (Danio rerio), SGK2)
Synonyms:
SGK2, Sgk2, sgk2a, sgk2
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4023973
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
serum/glucocorticoid Regulated Kinase 2 (SGK2)
Gene ID:
570956 (Zebrafish (Danio rerio), SGK2)
Synonyms:
SGK2, Sgk2, sgk2a, sgk2
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4023972
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
serum/glucocorticoid Regulated Kinase 2 (SGK2)
Gene ID:
10110 (Human, SGK2)
Synonyms:
SGK2, Sgk2, sgk2a, sgk2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3466114
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
serum/glucocorticoid Regulated Kinase 2 (SGK2)
Gene ID:
27219 (Mouse (Murine), SGK2)
Synonyms:
SGK2, Sgk2, sgk2a, sgk2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3812931
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
serum/glucocorticoid Regulated Kinase 2 (SGK2)
Gene ID:
517909 (Cow (Bovine), SGK2)
Synonyms:
SGK2, Sgk2, sgk2a, sgk2
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4063213
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
serum/glucocorticoid Regulated Kinase 2 (SGK2)
Gene ID:
10110 (Human, SGK2)
Synonyms:
SGK2, Sgk2, sgk2a, sgk2
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4088645
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
serum/glucocorticoid Regulated Kinase 2 (SGK2)
Species:
Human
Synonyms:
SGK2, Sgk2, sgk2a, sgk2
Insert length:
1104 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4839967
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
serum/glucocorticoid Regulated Kinase 2 (SGK2)
Species:
Human
Synonyms:
SGK2, Sgk2, sgk2a, sgk2
Insert length:
1104 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4710836
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression
Gene:
serum/glucocorticoid Regulated Kinase 2 (SGK2)
Species:
Human
Synonyms:
SGK2, Sgk2, sgk2a, sgk2
Insert length:
1815 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3392151
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
serum/glucocorticoid Regulated Kinase 2 (SGK2)
Gene ID:
10110 (Human, SGK2)
Synonyms:
SGK2, Sgk2, sgk2a, sgk2
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3410302
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to SGK2

  • SGK2, serine/threonine kinase 2 (SGK2)
  • serum/glucocorticoid regulated kinase 2 (Sgk2)
  • SGK2, serine/threonine kinase 2 (Sgk2)
  • serum/glucocorticoid regulated kinase 2a (sgk2a)
  • serum/glucocorticoid regulated kinase 2 (sgk2)
  • AI098171
  • AW146006
  • dJ138B7.2
  • fm82b06
  • H-SGK2
  • h-sgk2
  • sgk2
  • SGK2
  • SGK3
  • Sgkl
  • wu:fm82b06
  • zgc:172111
  • zgc:198213

Gene-IDs for different species

GENE IDSPECIES
10110 Homo sapiens
27219 Mus musculus
171497 Rattus norvegicus
419166 Gallus gallus
517909 Bos taurus
570956 Danio rerio
610835 Canis lupus familiaris
740699 Pan troglodytes
100036607 Xenopus (Silurana) tropicalis
100171824 Pongo abelii
100589087 Nomascus leucogenys
100352204 Oryctolagus cuniculus
100719215 Cavia porcellus

Protein level used designations for SGK2

  • serine/threonine-protein kinase Sgk2
  • serum/glucocorticoid-regulated kinase 2
  • serum/glucocorticoid regulated kinase family, member 3
  • serum/glucocorticoid regulated kinase 2
  • serine/threonine-protein kinase Sgk3
Other products related to SGK2 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com