SGPP2 (Sphingosine-1-Phosphate Phosphatase 2, SGPP2)

Short Description: Sphingosine-1-phosphate (S1P) is a bioactive sphingolipid metabolite that regulates diverse biologic processes. SGPP2 catalyzes the degradation of S1P (Ogawa et al., 2003 [PubMed 12411432]).[supplied by OMIM, Jun 2009].
More information related to gene SGPP2.
Products related to SGPP2 Gene:
85 Products
Type
  • 83
  • 2
Species
  • 35
  • 32
  • 16
  • 2
Application
  • 44
  • 23
  • 18
  • 16
Fusion tag
  • 31
  • 11
  • 9
  • 8
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 4
  • 4
Vector
  • 31
  • 26
  • 12
  • 6
  • 6
Insert
  • 37
  • 16
  • 14
  • 8
  • 6
Oligo-Type
  • 2
Resistance Gene
  • 35
  • 34
  • 12
  • 2
  • 2
Expression Type
  • 75
  • 44
Selectable Marker
  • 27
  • 22
  • 2
  • 1
Promoter
  • 26
  • 25
  • 13
  • 10
  • 8
Format
  • 25
  • 24
  • 20
  • 16

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Sphingosine-1-Phosphate Phosphatase 2 (SGPP2)
Gene ID:
433323 (Mouse (Murine), SGPP2)
Synonyms:
SGPP2, Sgpp2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3848992
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Sphingosine-1-Phosphate Phosphatase 2 (SGPP2)
Gene ID:
100036888 (Xenopus laevis, SGPP2)
Synonyms:
SGPP2, Sgpp2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS111
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • T3
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4033316
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Sphingosine-1-Phosphate Phosphatase 2 (SGPP2)
Gene ID:
433323 (Mouse (Murine), SGPP2)
Synonyms:
SGPP2, Sgpp2
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4020595
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Sphingosine-1-Phosphate Phosphatase 2 (SGPP2)
Gene ID:
433323 (Mouse (Murine), SGPP2)
Synonyms:
SGPP2, Sgpp2
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4020596
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Sphingosine-1-Phosphate Phosphatase 2 (SGPP2)
Gene ID:
130367 (Human, SGPP2)
Synonyms:
SGPP2, Sgpp2
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3992251
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Sphingosine-1-Phosphate Phosphatase 2 (SGPP2)
Gene ID:
433323 (Mouse (Murine), SGPP2)
Synonyms:
SGPP2, Sgpp2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3848994
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Sphingosine-1-Phosphate Phosphatase 2 (SGPP2)
Gene ID:
100036888 (Xenopus laevis, SGPP2)
Synonyms:
SGPP2, Sgpp2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS111
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • T3
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4033317
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Sphingosine-1-Phosphate Phosphatase 2 (SGPP2)
Gene ID:
433323 (Mouse (Murine), SGPP2)
Synonyms:
SGPP2, Sgpp2
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4020593
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Sphingosine-1-Phosphate Phosphatase 2 (SGPP2)
Gene ID:
433323 (Mouse (Murine), SGPP2)
Synonyms:
SGPP2, Sgpp2
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4020594
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Sphingosine-1-Phosphate Phosphatase 2 (SGPP2)
Gene ID:
130367 (Human, SGPP2)
Synonyms:
SGPP2, Sgpp2
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3992252
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Sphingosine-1-Phosphate Phosphatase 2 (SGPP2)
Gene ID:
130367 (Human, SGPP2)
Synonyms:
SGPP2, Sgpp2
Insert length:
1200 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5326111
$189.37
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Sphingosine-1-Phosphate Phosphatase 2 (SGPP2)
Gene ID:
130367 (Human, SGPP2)
Synonyms:
SGPP2, Sgpp2
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3415437
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Sphingosine-1-Phosphate Phosphatase 2 (SGPP2)
NCBI Accession:
NM_001191811,NP_001178740
Species:
Rat (Rattus)
Synonyms:
SGPP2, Sgpp2
Insert length:
1065 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3369853
$360.00
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Sphingosine-1-Phosphate Phosphatase 2 (SGPP2)
NCBI Accession:
NM_152386,NP_689599
Species:
Human
Synonyms:
SGPP2, Sgpp2
Insert length:
1200 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5408488
$420.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Sphingosine-1-Phosphate Phosphatase 2 (SGPP2)
Species:
Rat (Rattus)
Synonyms:
SGPP2, Sgpp2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5408489
$420.00
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Sphingosine-1-Phosphate Phosphatase 2 (SGPP2)
NCBI Accession:
NM_001004173,NP_001004173
Species:
Mouse (Murine)
Synonyms:
SGPP2, Sgpp2
Insert length:
1065 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3369852
$420.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Sphingosine-1-Phosphate Phosphatase 2 (SGPP2)
NCBI Accession:
NM_152386
Species:
Human
Synonyms:
SGPP2, Sgpp2
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of SGPP2
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5122740
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Sphingosine-1-Phosphate Phosphatase 2 (SGPP2)
NCBI Accession:
NM_001191811
Species:
Rat (Rattus)
Synonyms:
SGPP2, Sgpp2
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Sgpp2
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5122744
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Sphingosine-1-Phosphate Phosphatase 2 (SGPP2)
NCBI Accession:
NM_001004173
Species:
Mouse (Murine)
Synonyms:
SGPP2, Sgpp2
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Sgpp2
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5122742
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Application:
RNA Interference
Gene:
Sphingosine-1-Phosphate Phosphatase 2
Species:
Human
Synonyms:
SPP2, RGD1565739, SPPase2, Spp2
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • SGPP2 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3312095
$430.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days
  • <
  • 1

Synonyms and alternative names related to SGPP2

  • sphingosine-1-phosphate phosphatase 2 (SGPP2)
  • sphingosine-1-phosphate phosphatase 2 (Sgpp2)
  • sphingosine-1-phosphate phosphotase 2 (Sgpp2)
  • RGD1565739
  • SPP2
  • Spp2
  • SPPase2

Gene-IDs for different species

GENE IDSPECIES
470726 Pan troglodytes
705674 Macaca mulatta
100060934 Equus caballus
100407081 Callithrix jacchus
130367 Homo sapiens
301543 Rattus norvegicus
433323 Mus musculus

Protein level used designations for SGPP2

  • sphingosine 1-phosphate phosphohydrolase 2
  • sphingosine-1-phosphate phosphotase 2
  • sphingosine-1-phosphate phosphatase 2
  • sphingosine-1-phosphate phosphatase 2-like
  • SPPase2
  • hSPP2
  • sphingosine-1-phosphatase 2
Other products related to SGPP2 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com