SIGLEC10 (Sialic Acid Binding Ig-Like Lectin 10, SIGLEC10)

Short Description: SIGLECs are members of the immunoglobulin superfamily that are expressed on the cell surface. Most SIGLECs have 1 or more cytoplasmic immune receptor tyrosine-based inhibitory motifs, or ITIMs. SIGLECs are typically expressed on cells of the innate immune system, with the exception of the B-cell expressed SIGLEC6 (MIM 604405).[supplied by OMIM, Jul 2002].
More information related to gene SIGLEC10.
Products related to SIGLEC10 Gene:
117 Products
Type
  • 115
  • 2
Species
  • 98
  • 17
  • 2
Application
  • 87
  • 18
  • 11
  • 10
  • 1
Fusion tag
  • 32
  • 19
  • 17
  • 10
  • 10
Vector Backbone
  • 13
  • 9
  • 9
  • 7
  • 6
Vector
  • 62
  • 33
  • 8
  • 6
  • 3
Insert
  • 61
  • 34
  • 9
  • 5
  • 4
Oligo-Type
  • 1
  • 1
Resistance Gene
  • 51
  • 43
  • 20
  • 2
  • 1
Expression Type
  • 84
  • 40
  • 22
Selectable Marker
  • 38
  • 22
  • 14
Promoter
  • 47
  • 33
  • 16
  • 10
  • 6
Format
  • 74
  • 16
  • 15
  • 12

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Sialic Acid Binding Ig-Like Lectin 10 (SIGLEC10)
Gene ID:
100158511 (Xenopus tropicalis, SIGLEC10)
Synonyms:
SIGLEC10, Siglec10, LOC484343, LOC100066644, siglec10, LOC100513863, LOC100340374
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3874269
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Sialic Acid Binding Ig-Like Lectin 10 (SIGLEC10)
Gene ID:
89790 (Human, SIGLEC10)
Synonyms:
SIGLEC10, Siglec10, LOC484343, LOC100066644, siglec10, LOC100513863, LOC100340374
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4010159
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Sialic Acid Binding Ig-Like Lectin 10 (SIGLEC10)
Gene ID:
89790 (Human, SIGLEC10)
Synonyms:
SIGLEC10, Siglec10, LOC484343, LOC100066644, siglec10, LOC100513863, LOC100340374
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4010157
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Sialic Acid Binding Ig-Like Lectin 10 (SIGLEC10)
Gene ID:
89790 (Human, SIGLEC10)
Synonyms:
SIGLEC10, Siglec10, LOC484343, LOC100066644, siglec10, LOC100513863, LOC100340374
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4010158
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Sialic Acid Binding Ig-Like Lectin 10 (SIGLEC10)
NCBI Accession:
NM_001171157
Species:
Human
Synonyms:
SIGLEC10, Siglec10, LOC484343, LOC100066644, siglec10, LOC100513863, LOC100340374
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3585629
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Sialic Acid Binding Ig-Like Lectin 10 (SIGLEC10)
NCBI Accession:
NM_001171159
Species:
Human
Synonyms:
SIGLEC10, Siglec10, LOC484343, LOC100066644, siglec10, LOC100513863, LOC100340374
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3585630
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Sialic Acid Binding Ig-Like Lectin 10
Species:
Human
Synonyms:
PRO940, SIGLEC-10, SLG2, Siglecg, SIGLEC10, slg2, pro940, siglec-10
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3190775
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Sialic Acid Binding Ig-Like Lectin 10 (SIGLEC10)
Gene ID:
100158511 (Xenopus tropicalis, SIGLEC10)
Synonyms:
SIGLEC10, Siglec10, LOC484343, LOC100066644, siglec10, LOC100513863, LOC100340374
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3874268
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Sialic Acid Binding Ig-Like Lectin 10 (SIGLEC10)
Gene ID:
89790 (Human, SIGLEC10)
Synonyms:
SIGLEC10, Siglec10, LOC484343, LOC100066644, siglec10, LOC100513863, LOC100340374
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4010156
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Sialic Acid Binding Ig-Like Lectin 10 (SIGLEC10)
Gene ID:
89790 (Human, SIGLEC10)
Synonyms:
SIGLEC10, Siglec10, LOC484343, LOC100066644, siglec10, LOC100513863, LOC100340374
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4010161
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Sialic Acid Binding Ig-Like Lectin 10 (SIGLEC10)
Gene ID:
89790 (Human, SIGLEC10)
Synonyms:
SIGLEC10, Siglec10, LOC484343, LOC100066644, siglec10, LOC100513863, LOC100340374
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4010160
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Sialic Acid Binding Ig-Like Lectin 10 (SIGLEC10)
Gene ID:
89790 (Human, SIGLEC10)
Synonyms:
SIGLEC10, Siglec10, LOC484343, LOC100066644, siglec10, LOC100513863, LOC100340374
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3413956
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Sialic Acid Binding Ig-Like Lectin 10 (SIGLEC10)
NCBI Accession:
NM_001106250,NP_001099720
Species:
Rat (Rattus)
Synonyms:
SIGLEC10, Siglec10, LOC484343, LOC100066644, siglec10, LOC100513863, LOC100340374
Insert length:
1119 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3370055
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Sialic Acid Binding Ig-Like Lectin 10 (SIGLEC10)
NCBI Accession:
NM_001171158,NP_001164629
Species:
Human
Synonyms:
SIGLEC10, Siglec10, LOC484343, LOC100066644, siglec10, LOC100513863, LOC100340374
Insert length:
1665 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5407657
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Sialic Acid Binding Ig-Like Lectin 10 (SIGLEC10)
NCBI Accession:
NM_001171157,NP_001164628
Species:
Human
Synonyms:
SIGLEC10, Siglec10, LOC484343, LOC100066644, siglec10, LOC100513863, LOC100340374
Insert length:
1809 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5407658
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Sialic Acid Binding Ig-Like Lectin 10 (SIGLEC10)
NCBI Accession:
NM_001171156,NP_001164627
Species:
Human
Synonyms:
SIGLEC10, Siglec10, LOC484343, LOC100066644, siglec10, LOC100513863, LOC100340374
Insert length:
1920 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5407659
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Sialic Acid Binding Ig-Like Lectin 10 (SIGLEC10)
NCBI Accession:
NM_001171161,NP_001164632
Species:
Human
Synonyms:
SIGLEC10, Siglec10, LOC484343, LOC100066644, siglec10, LOC100513863, LOC100340374
Insert length:
1365 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5407654
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Sialic Acid Binding Ig-Like Lectin 10 (SIGLEC10)
NCBI Accession:
NM_001171159,NP_001164630
Species:
Human
Synonyms:
SIGLEC10, Siglec10, LOC484343, LOC100066644, siglec10, LOC100513863, LOC100340374
Insert length:
1635 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5407656
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Application:
RNA Interference
Gene:
Sialic Acid Binding Ig-Like Lectin 10
Species:
Human
Synonyms:
PRO940, SIGLEC-10, SLG2, Siglecg, SIGLEC10, slg2, pro940, siglec-10
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • SIGLEC10 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3310911
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Sialic Acid Binding Ig-Like Lectin 10 (SIGLEC10)
NCBI Accession:
NM_001106250
Species:
Rat (Rattus)
Synonyms:
SIGLEC10, Siglec10, LOC484343, LOC100066644, siglec10, LOC100513863, LOC100340374
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Siglec10
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5122236
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available
  • <
  • 1

Synonyms and alternative names related to SIGLEC10

  • sialic acid binding Ig like lectin 10 (SIGLEC10)
  • sialic acid binding Ig-like lectin 10 (Siglec10)
  • sialic acid-binding Ig-like lectin 10 (LOC484343)
  • sialic acid-binding Ig-like lectin 10 (LOC100066644)
  • sialic acid binding Ig-like lectin 10 (siglec10)
  • sialic acid-binding Ig-like lectin 10 (LOC100513863)
  • sialic acid-binding Ig-like lectin 10 (LOC100340374)
  • sialic acid binding Ig like lectin 10 (Siglec10)
  • pro940
  • PRO940
  • SIGLEC-10
  • siglec-10
  • SIGLEC10
  • Siglecg
  • SLG2
  • slg2

Gene-IDs for different species

GENE IDSPECIES
89790 Homo sapiens
292844 Rattus norvegicus
468977 Pan troglodytes
484343 Canis lupus familiaris
504258 Bos taurus
100066644 Equus caballus
100158511 Xenopus (Silurana) tropicalis
100478360 Ailuropoda melanoleuca
100513863 Sus scrofa
100595513 Nomascus leucogenys
100340374 Oryctolagus cuniculus
100713177 Cavia porcellus

Protein level used designations for SIGLEC10

  • sialic acid binding Ig-like lectin 10 Ig-like lectin 7
  • sialic acid-binding Ig-like lectin 10
  • siglec-like gene 2
  • siglec-like protein 2
  • sialic acid binding Ig-like lectin G
  • sialic acid binding Ig-like lectin 10
  • sialic acid-binding Ig-like lectin 10-like
Other products related to SIGLEC10 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com