SLC10A4 (Solute Carrier Family 10 (Sodium/bile Acid Cotransporter Family), Member 4, SLC10A4)

Products related to SLC10A4 Gene:
96 Products
Type
  • 92
  • 4
Species
  • 36
  • 31
  • 27
  • 2
Application
  • 44
  • 25
  • 25
  • 16
Fusion tag
  • 37
  • 15
  • 9
  • 9
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 5
  • 5
Vector
  • 33
  • 25
  • 12
  • 11
  • 9
Insert
  • 37
  • 21
  • 18
  • 8
  • 6
Oligo-Type
  • 4
Resistance Gene
  • 36
  • 33
  • 20
  • 3
  • 2
Expression Type
  • 82
  • 48
Selectable Marker
  • 28
  • 26
Promoter
  • 31
  • 28
  • 13
  • 8
  • 7
Format
  • 33
  • 27
  • 20
  • 16

Type:
cDNA
Application:
Cloning
Gene:
Solute Carrier Family 10 (Sodium/bile Acid Cotransporter Family), Member 4 (SLC10A4)
Gene ID:
231290 (Mouse (Murine), SLC10A4)
Synonyms:
SLC10A4, Slc10a4, slc10a4
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4013717
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Solute Carrier Family 10 (Sodium/bile Acid Cotransporter Family), Member 4 (SLC10A4)
Gene ID:
231290 (Mouse (Murine), SLC10A4)
Synonyms:
SLC10A4, Slc10a4, slc10a4
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4013718
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Solute Carrier Family 10 (Sodium/bile Acid Cotransporter Family), Member 4 (SLC10A4)
Gene ID:
540151 (Cow (Bovine), SLC10A4)
Synonyms:
SLC10A4, Slc10a4, slc10a4
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4064966
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Solute Carrier Family 10 (Sodium/bile Acid Cotransporter Family), Member 4 (SLC10A4)
Gene ID:
201780 (Human, SLC10A4)
Synonyms:
SLC10A4, Slc10a4, slc10a4
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4094861
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Solute Carrier Family 10 (Sodium/bile Acid Cotransporter Family), Member 4 (SLC10A4)
Gene ID:
201780 (Human, SLC10A4)
Synonyms:
SLC10A4, Slc10a4, slc10a4
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4094864
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Solute Carrier Family 10 (Sodium/bile Acid Cotransporter Family), Member 4 (SLC10A4)
Gene ID:
231290 (Mouse (Murine), SLC10A4)
Synonyms:
SLC10A4, Slc10a4, slc10a4
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4013719
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Solute Carrier Family 10 (Sodium/bile Acid Cotransporter Family), Member 4 (SLC10A4)
Gene ID:
540151 (Cow (Bovine), SLC10A4)
Synonyms:
SLC10A4, Slc10a4, slc10a4
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4064965
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Solute Carrier Family 10 (Sodium/bile Acid Cotransporter Family), Member 4 (SLC10A4)
Gene ID:
231290 (Mouse (Murine), SLC10A4)
Synonyms:
SLC10A4, Slc10a4, slc10a4
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4013716
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Solute Carrier Family 10 (Sodium/bile Acid Cotransporter Family), Member 4 (SLC10A4)
Gene ID:
201780 (Human, SLC10A4)
Synonyms:
SLC10A4, Slc10a4, slc10a4
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4094862
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Solute Carrier Family 10 (Sodium/bile Acid Cotransporter Family), Member 4 (SLC10A4)
Gene ID:
201780 (Human, SLC10A4)
Synonyms:
SLC10A4, Slc10a4, slc10a4
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4094863
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Solute Carrier Family 10 (Sodium/bile Acid Cotransporter Family), Member 4 (SLC10A4)
Gene ID:
201780 (Human, SLC10A4)
Synonyms:
SLC10A4, Slc10a4, slc10a4
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR221
Resistance Gene:
Kanamycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3420465
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Solute Carrier Family 10 (Sodium/bile Acid Cotransporter Family), Member 4 (SLC10A4)
Gene ID:
201780 (Human, SLC10A4)
Synonyms:
SLC10A4, Slc10a4, slc10a4
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR221
Resistance Gene:
Kanamycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3425245
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Solute Carrier Family 10 (Sodium/bile Acid Cotransporter Family), Member 4 (SLC10A4)
NCBI Accession:
NM_152679
Species:
Human
Synonyms:
SLC10A4, Slc10a4, slc10a4
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of SLC10A4
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5125294
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Solute Carrier Family 10 (Sodium/bile Acid Cotransporter Family), Member 4 (SLC10A4)
NCBI Accession:
NM_173403
Species:
Mouse (Murine)
Synonyms:
SLC10A4, Slc10a4, slc10a4
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Slc10a4
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5125296
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Solute Carrier Family 10 (Sodium/bile Acid Cotransporter Family), Member 4 (SLC10A4)
NCBI Accession:
NM_001008555
Species:
Rat (Rattus)
Synonyms:
SLC10A4, Slc10a4, slc10a4
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Slc10a4
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5125298
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
ORF
Application:
Protein Expression
Gene:
Solute Carrier Family 10 (Sodium/bile Acid Cotransporter Family), Member 4 (SLC10A4)
NCBI Accession:
NM_152679,NP_689892
Species:
Human
Synonyms:
SLC10A4, Slc10a4, slc10a4
Insert length:
1314 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5412789
$420.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Application:
RNA Interference
Gene:
Solute Carrier Family 10 (Sodium/bile Acid Cotransporter Family), Member 4
Species:
Mouse (Murine)
Synonyms:
P4, E130304D01, si:dkey-90m5.5
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Slc10a4 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3270445
$430.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Solute Carrier Family 10 (Sodium/bile Acid Cotransporter Family), Member 4
Species:
Rat (Rattus)
Synonyms:
P4, E130304D01, si:dkey-90m5.5
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Slc10a4 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3356128
$430.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Solute Carrier Family 10 (Sodium/bile Acid Cotransporter Family), Member 4
Species:
Human
Synonyms:
P4, E130304D01, si:dkey-90m5.5
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • SLC10A4 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3313396
$430.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Solute Carrier Family 10 (Sodium/bile Acid Cotransporter Family), Member 4 (SLC10A4)
Species:
Human
Synonyms:
SLC10A4, Slc10a4, slc10a4
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC-GFP
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
GFP tag
Expression:
Stable, Transient

Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5412788
$460.00
10 μg
Plus shipping costs $45.00
Will be delivered in 31 Business Days
  • <
  • 1

Synonyms and alternative names related to SLC10A4

  • solute carrier family 10 member 4 (SLC10A4)
  • solute carrier family 10 (sodium/bile acid cotransporter family), member 4 (Slc10a4)
  • solute carrier family 10, member 4 (Slc10a4)
  • solute carrier family 10, member 4 (slc10a4)
  • E130304D01
  • P4
  • si:dkey-90m5.5

Gene-IDs for different species

GENE IDSPECIES
201780 Homo sapiens
231290 Mus musculus
305309 Rattus norvegicus
471243 Pan troglodytes
540151 Bos taurus
556491 Danio rerio
705961 Macaca mulatta
770263 Gallus gallus
100061200 Equus caballus
100395782 Callithrix jacchus
100456573 Pongo abelii
100520624 Sus scrofa
100599770 Nomascus leucogenys

Protein level used designations for SLC10A4

  • Na(+)/bile acid cotransporter 4
  • bile acid transporter SLC10A4
  • sodium/bile acid cotransporter 4
  • solute carrier family 10 (sodium/bile acid cotransporter family), member 4
  • solute carrier family 10 member 4
  • bile acid transporter Slc10a4
  • solute carrier family 10, member 4
  • sodium/bile acid cotransporter 4-like
Other products related to SLC10A4 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com