SLC16A1 (Solute Carrier Family 16, Member 1 (Monocarboxylic Acid Transporter 1), SLC16A1)

Short Description: The protein encoded by this gene is a proton-linked monocarboxylate transporter that catalyzes the movement of many monocarboxylates, such as lactate and pyruvate, across the plasma membrane. Mutations in this gene are associated with erythrocyte lactate transporter defect. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2009].
More information related to gene SLC16A1.
Products related to SLC16A1 Gene:
128 Products
Data Quality
  • 1
Type
  • 125
  • 3
Species
  • 62
  • 29
  • 28
  • 4
  • 2
Application
  • 75
  • 36
  • 24
  • 16
Fusion tag
  • 48
  • 18
  • 12
  • 11
  • 8
Vector Backbone
  • 7
  • 7
  • 6
  • 6
  • 6
Vector
  • 50
  • 37
  • 14
  • 10
  • 9
Insert
  • 49
  • 39
  • 21
  • 8
  • 6
Oligo-Type
  • 3
Resistance Gene
  • 52
  • 49
  • 20
  • 4
  • 2
Expression Type
  • 102
  • 52
  • 11
Selectable Marker
  • 29
  • 26
  • 11
Promoter
  • 37
  • 31
  • 26
  • 16
  • 8
Format
  • 50
  • 31
  • 25
  • 22

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Solute Carrier Family 16, Member 1 (Monocarboxylic Acid Transporter 1) (SLC16A1)
Gene ID:
380088 (Xenopus laevis, SLC16A1)
Synonyms:
SLC16A1, slc16a1b, slc16a1.S, Slc16a1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3843651
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Solute Carrier Family 16, Member 1 (Monocarboxylic Acid Transporter 1) (SLC16A1)
Gene ID:
20501 (Mouse (Murine), SLC16A1)
Synonyms:
SLC16A1, slc16a1b, slc16a1.S, Slc16a1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3810610
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Solute Carrier Family 16, Member 1 (Monocarboxylic Acid Transporter 1) (SLC16A1)
Gene ID:
25027 (Rat (Rattus), SLC16A1)
Synonyms:
SLC16A1, slc16a1b, slc16a1.S, Slc16a1
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4045624
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Solute Carrier Family 16, Member 1 (Monocarboxylic Acid Transporter 1) (SLC16A1)
Gene ID:
548685 (Xenopus tropicalis, SLC16A1)
Synonyms:
SLC16A1, slc16a1b, slc16a1.S, Slc16a1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4021625
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Solute Carrier Family 16, Member 1 (Monocarboxylic Acid Transporter 1) (SLC16A1)
Gene ID:
505775 (Cow (Bovine), SLC16A1)
Synonyms:
SLC16A1, slc16a1b, slc16a1.S, Slc16a1
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4061370
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Solute Carrier Family 16, Member 1 (Monocarboxylic Acid Transporter 1) (SLC16A1)
Gene ID:
548685 (Xenopus tropicalis, SLC16A1)
Synonyms:
SLC16A1, slc16a1b, slc16a1.S, Slc16a1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3983923
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Solute Carrier Family 16, Member 1 (Monocarboxylic Acid Transporter 1) (SLC16A1)
Gene ID:
6566 (Human, SLC16A1)
Synonyms:
SLC16A1, slc16a1b, slc16a1.S, Slc16a1
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4211508
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Solute Carrier Family 16, Member 1 (Monocarboxylic Acid Transporter 1) (SLC16A1)
Gene ID:
6566 (Human, SLC16A1)
Synonyms:
SLC16A1, slc16a1b, slc16a1.S, Slc16a1
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4211511
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Solute Carrier Family 16, Member 1 (Monocarboxylic Acid Transporter 1) (SLC16A1)
NCBI Accession:
NM_003051
Species:
Human
Synonyms:
SLC16A1, slc16a1b, slc16a1.S, Slc16a1
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3565033
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Solute Carrier Family 16, Member 1 (Monocarboxylic Acid Transporter 1) (SLC16A1)
Gene ID:
380088 (Xenopus laevis, SLC16A1)
Synonyms:
SLC16A1, slc16a1b, slc16a1.S, Slc16a1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3843650
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Solute Carrier Family 16, Member 1 (Monocarboxylic Acid Transporter 1) (SLC16A1)
Gene ID:
20501 (Mouse (Murine), SLC16A1)
Synonyms:
SLC16A1, slc16a1b, slc16a1.S, Slc16a1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3810609
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Solute Carrier Family 16, Member 1 (Monocarboxylic Acid Transporter 1) (SLC16A1)
Gene ID:
25027 (Rat (Rattus), SLC16A1)
Synonyms:
SLC16A1, slc16a1b, slc16a1.S, Slc16a1
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4045623
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Solute Carrier Family 16, Member 1 (Monocarboxylic Acid Transporter 1) (SLC16A1)
Gene ID:
548685 (Xenopus tropicalis, SLC16A1)
Synonyms:
SLC16A1, slc16a1b, slc16a1.S, Slc16a1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4021624
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Solute Carrier Family 16, Member 1 (Monocarboxylic Acid Transporter 1) (SLC16A1)
Gene ID:
505775 (Cow (Bovine), SLC16A1)
Synonyms:
SLC16A1, slc16a1b, slc16a1.S, Slc16a1
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4061371
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Solute Carrier Family 16, Member 1 (Monocarboxylic Acid Transporter 1) (SLC16A1)
Gene ID:
548685 (Xenopus tropicalis, SLC16A1)
Synonyms:
SLC16A1, slc16a1b, slc16a1.S, Slc16a1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3983924
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Solute Carrier Family 16, Member 1 (Monocarboxylic Acid Transporter 1) (SLC16A1)
Gene ID:
6566 (Human, SLC16A1)
Synonyms:
SLC16A1, slc16a1b, slc16a1.S, Slc16a1
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4211509
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Solute Carrier Family 16, Member 1 (Monocarboxylic Acid Transporter 1) (SLC16A1)
Gene ID:
6566 (Human, SLC16A1)
Synonyms:
SLC16A1, slc16a1b, slc16a1.S, Slc16a1
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4211510
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Solute Carrier Family 16, Member 1 (Monocarboxylic Acid Transporter 1) (SLC16A1)
Gene ID:
6566 (Human, SLC16A1)
Synonyms:
SLC16A1, slc16a1b, slc16a1.S, Slc16a1
Insert length:
1293 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5326069
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Solute Carrier Family 16, Member 1 (Monocarboxylic Acid Transporter 1) (SLC16A1)
NCBI Accession:
NM_003051,NP_003042
Species:
Human
Synonyms:
SLC16A1, slc16a1b, slc16a1.S, Slc16a1
Insert length:
4000 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3386735
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Solute Carrier Family 16, Member 1 (Monocarboxylic Acid Transporter 1) (SLC16A1)
Species:
Human
Synonyms:
SLC16A1, slc16a1b, slc16a1.S, Slc16a1
Insert length:
1503 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4711024
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to SLC16A1

  • solute carrier family 16 member 1 (SLC16A1)
  • solute carrier family 16 (monocarboxylate transporter), member 1b (slc16a1b)
  • solute carrier family 16 member 1 S homeolog (slc16a1.S)
  • solute carrier family 16 (monocarboxylic acid transporters), member 1 (Slc16a1)
  • solute carrier family 16 member 1 (Slc16a1)
  • AL022710
  • cb517
  • DKFZp469B1212
  • HHF7
  • MCT
  • MCT1
  • Mct1
  • MCT1a
  • MGC52993
  • RATMCT1
  • RNMCT1
  • slc16a1
  • SLC16A1
  • zgc:55682

Gene-IDs for different species

GENE IDSPECIES
6566 Homo sapiens
368274 Danio rerio
380088 Xenopus laevis
443456 Ovis aries
457096 Pan troglodytes
100009694 Equus caballus
100174496 Pongo abelii
100398254 Callithrix jacchus
100480919 Ailuropoda melanoleuca
100582053 Nomascus leucogenys
20501 Mus musculus
25027 Rattus norvegicus
505775 Bos taurus
100775004 Cricetulus griseus

Protein level used designations for SLC16A1

  • MCT 1
  • monocarboxylate transporter 1
  • solute carrier family 16 (monocarboxylic acid transporters), member 1
  • solute carrier family 16 member 1
  • solute carrier family 16, member 1 (monocarboxylic acid transporter 1)
  • MCT1
  • monocarboxylate transporter 1a
  • monocarboxylate transporter 1-like
  • solute carrier 16 (monocarboxylic acid transporter), member 1
  • Monocarboxylate transporter 1
  • monocarboxylate transporter 1-like protein
  • solute carrier family 16 (monocarboxylate transporter), member 1
Other products related to SLC16A1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com