SLC1A5 (Solute Carrier Family 1 Member 5, SLC1A5)

Short Description: The SLC1A5 gene encodes a sodium-dependent neutral amino acid transporter that can act as a receptor for RD114/type D retrovirus (Larriba et al., 2001 [PubMed 11781704]).[supplied by OMIM, Jan 2011].
More information related to gene SLC1A5.
Products related to SLC1A5 Gene:
125 Products
Type
  • 123
  • 2
Species
  • 50
  • 41
  • 28
  • 2
  • 2
Application
  • 81
  • 31
  • 21
  • 16
Fusion tag
  • 44
  • 18
  • 14
  • 11
  • 8
Vector Backbone
  • 8
  • 8
  • 6
  • 6
  • 6
Vector
  • 52
  • 40
  • 12
  • 9
  • 5
Insert
  • 45
  • 43
  • 19
  • 8
  • 6
Oligo-Type
  • 2
Resistance Gene
  • 49
  • 45
  • 24
  • 5
  • 2
Expression Type
  • 105
  • 52
  • 11
Selectable Marker
  • 26
  • 26
  • 11
  • 1
Promoter
  • 39
  • 30
  • 29
  • 14
  • 8
Format
  • 54
  • 27
  • 22
  • 22

Type:
ORF
Application:
Cloning
Gene:
Solute Carrier Family 1 Member 5 (SLC1A5)
Species:
Human
Synonyms:
slc1a5, slc1a5.S, SLC1A5, Slc1a5
Insert length:
1626 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5729567
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Solute Carrier Family 1 Member 5 (SLC1A5)
NCBI Accession:
NM_005628,NP_005619
Species:
Human
Synonyms:
slc1a5, slc1a5.S, SLC1A5, Slc1a5
Insert length:
1626 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5365810
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Solute Carrier Family 1 Member 5 (SLC1A5)
Gene ID:
20514 (Mouse (Murine), SLC1A5)
Synonyms:
slc1a5, slc1a5.S, SLC1A5, Slc1a5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3810626
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Solute Carrier Family 1 Member 5 (SLC1A5)
Gene ID:
20514 (Mouse (Murine), SLC1A5)
Synonyms:
slc1a5, slc1a5.S, SLC1A5, Slc1a5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3810625
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Solute Carrier Family 1 Member 5 (SLC1A5)
Gene ID:
282355 (Cow (Bovine), SLC1A5)
Synonyms:
slc1a5, slc1a5.S, SLC1A5, Slc1a5
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4049161
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Solute Carrier Family 1 Member 5 (SLC1A5)
Gene ID:
292657 (Rat (Rattus), SLC1A5)
Synonyms:
slc1a5, slc1a5.S, SLC1A5, Slc1a5
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4050260
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Solute Carrier Family 1 Member 5 (SLC1A5)
Gene ID:
6510 (Human, SLC1A5)
Synonyms:
slc1a5, slc1a5.S, SLC1A5, Slc1a5
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4086806
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Solute Carrier Family 1 Member 5 (SLC1A5)
Gene ID:
493489 (Xenopus tropicalis, SLC1A5)
Synonyms:
slc1a5, slc1a5.S, SLC1A5, Slc1a5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3886078
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Solute Carrier Family 1 Member 5 (SLC1A5)
Gene ID:
444522 (Xenopus laevis, SLC1A5)
Synonyms:
slc1a5, slc1a5.S, SLC1A5, Slc1a5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3850604
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Solute Carrier Family 1 Member 5 (SLC1A5)
NCBI Accession:
NM_009201
Species:
Mouse (Murine)
Synonyms:
slc1a5, slc1a5.S, SLC1A5, Slc1a5
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3586466
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Solute Carrier Family 1 Member 5 (SLC1A5)
Gene ID:
20514 (Mouse (Murine), SLC1A5)
Synonyms:
slc1a5, slc1a5.S, SLC1A5, Slc1a5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3810624
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Solute Carrier Family 1 Member 5 (SLC1A5)
Gene ID:
20514 (Mouse (Murine), SLC1A5)
Synonyms:
slc1a5, slc1a5.S, SLC1A5, Slc1a5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3810627
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Solute Carrier Family 1 Member 5 (SLC1A5)
Gene ID:
282355 (Cow (Bovine), SLC1A5)
Synonyms:
slc1a5, slc1a5.S, SLC1A5, Slc1a5
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4049160
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Solute Carrier Family 1 Member 5 (SLC1A5)
Gene ID:
292657 (Rat (Rattus), SLC1A5)
Synonyms:
slc1a5, slc1a5.S, SLC1A5, Slc1a5
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4050259
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Solute Carrier Family 1 Member 5 (SLC1A5)
Gene ID:
6510 (Human, SLC1A5)
Synonyms:
slc1a5, slc1a5.S, SLC1A5, Slc1a5
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4086807
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Solute Carrier Family 1 Member 5 (SLC1A5)
Gene ID:
493489 (Xenopus tropicalis, SLC1A5)
Synonyms:
slc1a5, slc1a5.S, SLC1A5, Slc1a5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3886077
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Solute Carrier Family 1 Member 5 (SLC1A5)
Gene ID:
444522 (Xenopus laevis, SLC1A5)
Synonyms:
slc1a5, slc1a5.S, SLC1A5, Slc1a5
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3850605
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Solute Carrier Family 1 Member 5 (SLC1A5)
Gene ID:
6510 (Human, SLC1A5)
Synonyms:
slc1a5, slc1a5.S, SLC1A5, Slc1a5
Insert length:
1626 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5323442
$199.17
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Solute Carrier Family 1 Member 5 (SLC1A5)
Species:
Human
Synonyms:
slc1a5, slc1a5.S, SLC1A5, Slc1a5
Insert length:
1626 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4416083
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Solute Carrier Family 1 Member 5 (SLC1A5)
Species:
Human
Synonyms:
slc1a5, slc1a5.S, SLC1A5, Slc1a5
Insert length:
1626 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4481169
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to SLC1A5

  • solute carrier family 1 (neutral amino acid transporter), member 5 (slc1a5)
  • solute carrier family 1 member 5 S homeolog (slc1a5.S)
  • solute carrier family 1 member 5 (SLC1A5)
  • solute carrier family 1 (neutral amino acid transporter), member 5 (Slc1a5)
  • solute carrier family 1 member 5 (Slc1a5)
  • aaat
  • AAAT
  • Asct2
  • asct2
  • ASCT2
  • atbo
  • ATBO
  • H4-ASCT2
  • m7v1
  • M7V1
  • m7vs1
  • M7VS1
  • r16
  • R16
  • rdrc
  • RDRC
  • Slc1a7

Gene-IDs for different species

GENE IDSPECIES
100002129 Danio rerio
444522 Xenopus laevis
6510 Homo sapiens
484425 Canis lupus familiaris
282355 Bos taurus
100009234 Oryctolagus cuniculus
20514 Mus musculus
292657 Rattus norvegicus

Protein level used designations for SLC1A5

  • neutral amino acid transporter B(0)
  • ATB(0)
  • RD114 virus receptor
  • RD114/simian type D retrovirus receptor
  • baboon M7 virus receptor
  • neutral amino acid transporter B
  • sodium-dependent neutral amino acid transporter type 2
  • solute carrier family 1 member 5
  • alanine/serine/cysteine/threonine transporter 2
  • neutral amino acid transporter B0
  • ASC-like Na(+)-dependent neutral amino acid transporter ASCT2
  • insulin-activated amino acid transporter
  • solute carrier family 1, member 7
  • CAZ-associated structural protein
  • H4-system ASC-like transporter
  • sodium-dependent neutral amino acid transporter ASCT2
Other products related to SLC1A5 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com