SLC38A1 (Solute Carrier Family 38 Member 1, SLC38A1)

Short Description: Amino acid transporters play essential roles in the uptake of nutrients, production of energy, chemical metabolism, detoxification, and neurotransmitter cycling. SLC38A1 is an important transporter of glutamine, an intermediate in the detoxification of ammonia and the production of urea. Glutamine serves as a precursor for the synaptic transmitter, glutamate (Gu et al., 2001 [PubMed 11325958]).[supplied by OMIM, Mar 2008].
More information related to gene SLC38A1.
Products related to SLC38A1 Gene:
157 Products
Type
  • 154
  • 3
Species
  • 66
  • 62
  • 29
Application
  • 101
  • 34
  • 24
  • 16
Fusion tag
  • 40
  • 22
  • 20
  • 19
  • 9
Vector Backbone
  • 11
  • 11
  • 9
  • 6
  • 6
Vector
  • 70
  • 45
  • 20
  • 9
  • 6
Insert
  • 65
  • 52
  • 21
  • 8
  • 6
Oligo-Type
  • 3
Resistance Gene
  • 79
  • 41
  • 28
  • 6
  • 2
Expression Type
  • 125
  • 60
  • 24
Selectable Marker
  • 36
  • 26
  • 24
Promoter
  • 56
  • 36
  • 31
  • 21
  • 8
Format
  • 74
  • 45
  • 26
  • 12

Type:
ORF
Application:
Cloning
Gene:
Solute Carrier Family 38 Member 1 (SLC38A1)
Species:
Human
Synonyms:
SLC38A1, Slc38a1
Insert length:
1464 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5742377
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Solute Carrier Family 38 Member 1 (SLC38A1)
Gene ID:
170567 (Rat (Rattus), SLC38A1)
Synonyms:
SLC38A1, Slc38a1
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4048193
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Solute Carrier Family 38 Member 1 (SLC38A1)
Gene ID:
81539 (Human, SLC38A1)
Synonyms:
SLC38A1, Slc38a1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3827331
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Solute Carrier Family 38 Member 1 (SLC38A1)
Gene ID:
105727 (Mouse (Murine), SLC38A1)
Synonyms:
SLC38A1, Slc38a1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3830135
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Solute Carrier Family 38 Member 1 (SLC38A1)
NCBI Accession:
NM_001166458
Species:
Mouse (Murine)
Synonyms:
SLC38A1, Slc38a1
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3565095
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Solute Carrier Family 38 Member 1 (SLC38A1)
NCBI Accession:
NM_001278387
Species:
Human
Synonyms:
SLC38A1, Slc38a1
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3565096
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Solute Carrier Family 38 Member 1 (SLC38A1)
Gene ID:
170567 (Rat (Rattus), SLC38A1)
Synonyms:
SLC38A1, Slc38a1
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4048194
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Solute Carrier Family 38 Member 1 (SLC38A1)
Gene ID:
81539 (Human, SLC38A1)
Synonyms:
SLC38A1, Slc38a1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3827332
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Solute Carrier Family 38 Member 1 (SLC38A1)
Gene ID:
105727 (Mouse (Murine), SLC38A1)
Synonyms:
SLC38A1, Slc38a1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3830136
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Solute Carrier Family 38 Member 1 (SLC38A1)
Gene ID:
81539 (Human, SLC38A1)
Synonyms:
SLC38A1, Slc38a1
Insert length:
1464 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5317479
$189.37
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Solute Carrier Family 38 Member 1 (SLC38A1)
Species:
Human
Synonyms:
SLC38A1, Slc38a1
Insert length:
1464 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4416194
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Solute Carrier Family 38 Member 1 (SLC38A1)
Species:
Human
Synonyms:
SLC38A1, Slc38a1
Insert length:
1464 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4481280
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Solute Carrier Family 38 Member 1 (SLC38A1)
Species:
Human
Synonyms:
SLC38A1, Slc38a1
Insert length:
1464 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4711230
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Solute Carrier Family 38 Member 1 (SLC38A1)
Species:
Human
Synonyms:
SLC38A1, Slc38a1
Insert length:
1464 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4840361
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Solute Carrier Family 38 Member 1 (SLC38A1)
Species:
Human
Synonyms:
SLC38A1, Slc38a1
Insert length:
1464 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4624751
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Solute Carrier Family 38 Member 1 (SLC38A1)
Species:
Human
Synonyms:
SLC38A1, Slc38a1
Insert length:
1464 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-C-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4772948
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Solute Carrier Family 38 Member 1 (SLC38A1)
Gene ID:
81539 (Human, SLC38A1)
Synonyms:
SLC38A1, Slc38a1
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR221
Resistance Gene:
Kanamycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3425091
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Solute Carrier Family 38 Member 1 (SLC38A1)
Gene ID:
81539 (Human, SLC38A1)
Synonyms:
SLC38A1, Slc38a1
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR221
Resistance Gene:
Kanamycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3418856
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Solute Carrier Family 38 Member 1 (SLC38A1)
NCBI Accession:
NM_001077484,NP_001070952
Species:
Human
Synonyms:
SLC38A1, Slc38a1
Insert length:
1464 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5407901
$420.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Solute Carrier Family 38 Member 1 (SLC38A1)
NCBI Accession:
NM_030674,NP_109599
Species:
Human
Synonyms:
SLC38A1, Slc38a1
Insert length:
1584 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5407902
$420.00
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days
  • <
  • 1

Synonyms and alternative names related to SLC38A1

  • solute carrier family 38 member 1 (SLC38A1)
  • solute carrier family 38, member 1 (Slc38a1)
  • AA408026
  • AA409865
  • AL022800
  • ATA1
  • Ata1
  • AU015942
  • GlnT
  • NAT2
  • SAT1
  • Sat1
  • SNAT1

Gene-IDs for different species

GENE IDSPECIES
702135 Macaca mulatta
100154364 Sus scrofa
81539 Homo sapiens
477633 Canis lupus familiaris
105727 Mus musculus
170567 Rattus norvegicus

Protein level used designations for SLC38A1

  • sodium-coupled neutral amino acid transporter 1
  • solute carrier family 38, member 1
  • N-system amino acid transporter 2
  • amino acid transporter A1
  • amino acid transporter system A1
  • system A amino acid transporter 1
  • system N amino acid transporter 1
  • MNat2
  • glutamine transporter
  • rATA1
  • system A transporter 2
Other products related to SLC38A1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com