SNRPC (Small Nuclear Ribonucleoprotein Polypeptide C, SNRPC)

Short Description: This gene encodes one of the specific protein components of the U1 small nuclear ribonucleoprotein (snRNP) particle required for the formation of the spliceosome. The encoded protein participates in the processing of nuclear precursor messenger RNA splicing. snRNP particles are attacked by autoantibodies frequently produced by patients with connective tissue diseases. The genome contains several pseudogenes of this functional gene. Alternative splicing results in a non-coding transcript variant.[provided by RefSeq, Oct 2009].
More information related to gene SNRPC.
Products related to SNRPC Gene:
85 Products
Type
  • 82
  • 3
Species
  • 40
  • 30
  • 6
  • 3
  • 2
Application
  • 44
  • 31
  • 18
  • 12
Fusion tag
  • 39
  • 12
  • 8
  • 6
  • 6
Vector Backbone
  • 8
  • 4
  • 4
  • 4
  • 4
Vector
  • 31
  • 25
  • 10
  • 8
  • 6
Insert
  • 38
  • 17
  • 15
  • 6
  • 4
Oligo-Type
  • 3
Resistance Gene
  • 38
  • 28
  • 12
  • 4
  • 2
Expression Type
  • 72
  • 36
  • 2
Selectable Marker
  • 22
  • 18
  • 4
  • 1
Promoter
  • 23
  • 23
  • 15
  • 9
  • 6
Format
  • 27
  • 25
  • 18
  • 15

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Small Nuclear Ribonucleoprotein Polypeptide C (SNRPC)
Gene ID:
614553 (Cow (Bovine), SNRPC)
Synonyms:
SNRPC, Snrpc, snrpc, CAALFM_C206300WA, snrpc.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3866166
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Small Nuclear Ribonucleoprotein Polypeptide C (SNRPC)
Gene ID:
399324 (Xenopus laevis, SNRPC)
Synonyms:
SNRPC, Snrpc, snrpc, CAALFM_C206300WA, snrpc.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3846731
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Small Nuclear Ribonucleoprotein Polypeptide C (SNRPC)
Gene ID:
549352 (Xenopus tropicalis, SNRPC)
Synonyms:
SNRPC, Snrpc, snrpc, CAALFM_C206300WA, snrpc.S
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4022398
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Small Nuclear Ribonucleoprotein Polypeptide C (SNRPC)
Gene ID:
549352 (Xenopus tropicalis, SNRPC)
Synonyms:
SNRPC, Snrpc, snrpc, CAALFM_C206300WA, snrpc.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS108
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4030444
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Small Nuclear Ribonucleoprotein Polypeptide C (SNRPC)
Gene ID:
549352 (Xenopus tropicalis, SNRPC)
Synonyms:
SNRPC, Snrpc, snrpc, CAALFM_C206300WA, snrpc.S
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4022399
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Small Nuclear Ribonucleoprotein Polypeptide C (SNRPC)
Gene ID:
6631 (Human, SNRPC)
Synonyms:
SNRPC, Snrpc, snrpc, CAALFM_C206300WA, snrpc.S
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3986476
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Small Nuclear Ribonucleoprotein Polypeptide C (SNRPC)
Gene ID:
6631 (Human, SNRPC)
Synonyms:
SNRPC, Snrpc, snrpc, CAALFM_C206300WA, snrpc.S
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3986477
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Small Nuclear Ribonucleoprotein Polypeptide C (SNRPC)
Gene ID:
20630 (Mouse (Murine), SNRPC)
Synonyms:
SNRPC, Snrpc, snrpc, CAALFM_C206300WA, snrpc.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4217335
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Small Nuclear Ribonucleoprotein Polypeptide C (SNRPC)
Gene ID:
20630 (Mouse (Murine), SNRPC)
Synonyms:
SNRPC, Snrpc, snrpc, CAALFM_C206300WA, snrpc.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4217338
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Small Nuclear Ribonucleoprotein Polypeptide C (SNRPC)
Gene ID:
614553 (Cow (Bovine), SNRPC)
Synonyms:
SNRPC, Snrpc, snrpc, CAALFM_C206300WA, snrpc.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3866167
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Small Nuclear Ribonucleoprotein Polypeptide C (SNRPC)
Gene ID:
399324 (Xenopus laevis, SNRPC)
Synonyms:
SNRPC, Snrpc, snrpc, CAALFM_C206300WA, snrpc.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3846730
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Small Nuclear Ribonucleoprotein Polypeptide C (SNRPC)
Gene ID:
549352 (Xenopus tropicalis, SNRPC)
Synonyms:
SNRPC, Snrpc, snrpc, CAALFM_C206300WA, snrpc.S
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4022400
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Small Nuclear Ribonucleoprotein Polypeptide C (SNRPC)
Gene ID:
549352 (Xenopus tropicalis, SNRPC)
Synonyms:
SNRPC, Snrpc, snrpc, CAALFM_C206300WA, snrpc.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS108
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4030443
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Small Nuclear Ribonucleoprotein Polypeptide C (SNRPC)
Gene ID:
549352 (Xenopus tropicalis, SNRPC)
Synonyms:
SNRPC, Snrpc, snrpc, CAALFM_C206300WA, snrpc.S
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4022401
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Small Nuclear Ribonucleoprotein Polypeptide C (SNRPC)
Gene ID:
6631 (Human, SNRPC)
Synonyms:
SNRPC, Snrpc, snrpc, CAALFM_C206300WA, snrpc.S
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3986479
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Small Nuclear Ribonucleoprotein Polypeptide C (SNRPC)
Gene ID:
6631 (Human, SNRPC)
Synonyms:
SNRPC, Snrpc, snrpc, CAALFM_C206300WA, snrpc.S
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3986478
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Small Nuclear Ribonucleoprotein Polypeptide C (SNRPC)
Gene ID:
20630 (Mouse (Murine), SNRPC)
Synonyms:
SNRPC, Snrpc, snrpc, CAALFM_C206300WA, snrpc.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4217336
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Small Nuclear Ribonucleoprotein Polypeptide C (SNRPC)
Gene ID:
20630 (Mouse (Murine), SNRPC)
Synonyms:
SNRPC, Snrpc, snrpc, CAALFM_C206300WA, snrpc.S
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4217337
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Small Nuclear Ribonucleoprotein Polypeptide C (SNRPC)
Gene ID:
6631 (Human, SNRPC)
Synonyms:
SNRPC, Snrpc, snrpc, CAALFM_C206300WA, snrpc.S
Insert length:
480 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5325098
$184.46
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Small Nuclear Ribonucleoprotein Polypeptide C (SNRPC)
NCBI Accession:
NM_001271040,NP_001257969
Species:
Rat (Rattus)
Synonyms:
SNRPC, Snrpc, snrpc, CAALFM_C206300WA, snrpc.S
Insert length:
480 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3371461
$200.00
10 μg
Plus shipping costs $45.00
Will be delivered in 16 Business Days
  • <
  • 1

Synonyms and alternative names related to SNRPC

  • small nuclear ribonucleoprotein polypeptide C (SNRPC)
  • U1 small nuclear ribonucleoprotein C (Snrpc)
  • small nuclear ribonucleoprotein polypeptide C (snrpc)
  • small nuclear ribonucleoprotein polypeptide C (Snrpc)
  • hypothetical protein (CAALFM_C206300WA)
  • small nuclear ribonucleoprotein polypeptide C S homeolog (snrpc.S)
  • chunp6909
  • MGC109792
  • Snrp1c
  • snrp1c
  • snrpc
  • U1 snRNP C
  • U1-C
  • U1C
  • Yhc1
  • zgc:109792

Gene-IDs for different species

GENE IDSPECIES
6631 Homo sapiens
20630 Mus musculus
192330 Danio rerio
361808 Rattus norvegicus
614553 Bos taurus
100354438 Oryctolagus cuniculus
419901 Gallus gallus
608109 Canis lupus familiaris
100154606 Sus scrofa
3646924 Candida albicans SC5314
100732863 Cavia porcellus
101116434 Ovis aries
399324 Xenopus laevis

Protein level used designations for SNRPC

  • U1 small nuclear RNP specific C
  • U1 small nuclear ribonucleoprotein C
  • U1 snRNP C
  • U1 snRNP protein C
  • U1 small nuclear ribonucleoprotein 1C
  • U1-C
  • hypothetical protein
  • snRNP C protein
Other products related to SNRPC such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com