SNRPD1 (Small Nuclear Ribonucleoprotein D1 Polypeptide 16kDa, SNRPD1)

Short Description: This gene encodes a small nuclear ribonucleoprotein that belongs to the SNRNP core protein family. The protein may act as a charged protein scaffold to promote SNRNP assembly or strengthen SNRNP-SNRNP interactions through nonspecific electrostatic contacts with RNA. [provided by RefSeq, Jul 2008].
More information related to gene SNRPD1.
Products related to SNRPD1 Gene:
107 Products
Type
  • 104
  • 3
Species
  • 38
  • 29
  • 28
  • 6
  • 2
Application
  • 60
  • 36
  • 23
  • 16
Fusion tag
  • 46
  • 14
  • 10
  • 9
  • 8
Vector Backbone
  • 8
  • 6
  • 6
  • 6
  • 6
Vector
  • 42
  • 33
  • 12
  • 9
  • 7
Insert
  • 48
  • 20
  • 20
  • 8
  • 6
Oligo-Type
  • 3
Resistance Gene
  • 45
  • 35
  • 20
  • 4
  • 2
Expression Type
  • 99
  • 49
Selectable Marker
  • 26
  • 26
Promoter
  • 30
  • 30
  • 22
  • 13
  • 8
Format
  • 36
  • 27
  • 24
  • 20

Type:
ORF
Application:
Protein Expression
Gene:
Small Nuclear Ribonucleoprotein D1 Polypeptide 16kDa (SNRPD1)
NCBI Accession:
NM_006938,NP_008869
Species:
Human
Synonyms:
SNRPD1, Snrpd1, snrpd1, snrpd1.L
Insert length:
360 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5458356
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Small Nuclear Ribonucleoprotein D1 Polypeptide 16kDa (SNRPD1)
Gene ID:
192331 (Zebrafish (Danio rerio), SNRPD1)
Synonyms:
SNRPD1, Snrpd1, snrpd1, snrpd1.L
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4039902
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Small Nuclear Ribonucleoprotein D1 Polypeptide 16kDa (SNRPD1)
Gene ID:
508788 (Cow (Bovine), SNRPD1)
Synonyms:
SNRPD1, Snrpd1, snrpd1, snrpd1.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3856089
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Small Nuclear Ribonucleoprotein D1 Polypeptide 16kDa (SNRPD1)
Gene ID:
6632 (Human, SNRPD1)
Synonyms:
SNRPD1, Snrpd1, snrpd1, snrpd1.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3465012
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Small Nuclear Ribonucleoprotein D1 Polypeptide 16kDa (SNRPD1)
Gene ID:
443747 (Xenopus laevis, SNRPD1)
Synonyms:
SNRPD1, Snrpd1, snrpd1, snrpd1.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3849164
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Small Nuclear Ribonucleoprotein D1 Polypeptide 16kDa (SNRPD1)
Gene ID:
443747 (Xenopus laevis, SNRPD1)
Synonyms:
SNRPD1, Snrpd1, snrpd1, snrpd1.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS111
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • T3
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4033136
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Small Nuclear Ribonucleoprotein D1 Polypeptide 16kDa (SNRPD1)
Gene ID:
6632 (Human, SNRPD1)
Synonyms:
SNRPD1, Snrpd1, snrpd1, snrpd1.L
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4086891
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Small Nuclear Ribonucleoprotein D1 Polypeptide 16kDa (SNRPD1)
Gene ID:
443747 (Xenopus laevis, SNRPD1)
Synonyms:
SNRPD1, Snrpd1, snrpd1, snrpd1.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4058035
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Small Nuclear Ribonucleoprotein D1 Polypeptide 16kDa (SNRPD1)
Gene ID:
291794 (Rat (Rattus), SNRPD1)
Synonyms:
SNRPD1, Snrpd1, snrpd1, snrpd1.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4050151
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Small Nuclear Ribonucleoprotein D1 Polypeptide 16kDa (SNRPD1)
Gene ID:
447999 (Xenopus tropicalis, SNRPD1)
Synonyms:
SNRPD1, Snrpd1, snrpd1, snrpd1.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3884773
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Small Nuclear Ribonucleoprotein D1 Polypeptide 16kDa (SNRPD1)
Gene ID:
20641 (Mouse (Murine), SNRPD1)
Synonyms:
SNRPD1, Snrpd1, snrpd1, snrpd1.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4217346
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Small Nuclear Ribonucleoprotein D1 Polypeptide 16kDa (SNRPD1)
Gene ID:
192331 (Zebrafish (Danio rerio), SNRPD1)
Synonyms:
SNRPD1, Snrpd1, snrpd1, snrpd1.L
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4039903
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Small Nuclear Ribonucleoprotein D1 Polypeptide 16kDa (SNRPD1)
Species:
Human
Synonyms:
SNRPD1, Snrpd1, snrpd1, snrpd1.L
Insert length:
360 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5757902
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Small Nuclear Ribonucleoprotein D1 Polypeptide 16kDa (SNRPD1)
Gene ID:
508788 (Cow (Bovine), SNRPD1)
Synonyms:
SNRPD1, Snrpd1, snrpd1, snrpd1.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3856088
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Small Nuclear Ribonucleoprotein D1 Polypeptide 16kDa (SNRPD1)
Gene ID:
6632 (Human, SNRPD1)
Synonyms:
SNRPD1, Snrpd1, snrpd1, snrpd1.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3465013
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Small Nuclear Ribonucleoprotein D1 Polypeptide 16kDa (SNRPD1)
Gene ID:
443747 (Xenopus laevis, SNRPD1)
Synonyms:
SNRPD1, Snrpd1, snrpd1, snrpd1.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3849163
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Small Nuclear Ribonucleoprotein D1 Polypeptide 16kDa (SNRPD1)
Gene ID:
443747 (Xenopus laevis, SNRPD1)
Synonyms:
SNRPD1, Snrpd1, snrpd1, snrpd1.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS111
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • T3
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4033137
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Small Nuclear Ribonucleoprotein D1 Polypeptide 16kDa (SNRPD1)
Gene ID:
6632 (Human, SNRPD1)
Synonyms:
SNRPD1, Snrpd1, snrpd1, snrpd1.L
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4086890
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Small Nuclear Ribonucleoprotein D1 Polypeptide 16kDa (SNRPD1)
Gene ID:
443747 (Xenopus laevis, SNRPD1)
Synonyms:
SNRPD1, Snrpd1, snrpd1, snrpd1.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4058034
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Small Nuclear Ribonucleoprotein D1 Polypeptide 16kDa (SNRPD1)
Gene ID:
291794 (Rat (Rattus), SNRPD1)
Synonyms:
SNRPD1, Snrpd1, snrpd1, snrpd1.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4050150
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to SNRPD1

  • small nuclear ribonucleoprotein D1 polypeptide (SNRPD1)
  • small nuclear ribonucleoprotein D1 (Snrpd1)
  • small nuclear ribonucleoprotein D1 polypeptide (Snrpd1)
  • small nuclear ribonucleoprotein D1 polypeptide (snrpd1)
  • small nuclear ribonucleoprotein D1 polypeptide L homeolog (snrpd1.L)
  • AA407109
  • AL023031
  • CHUNP6882
  • fk26a01
  • HsT2456
  • Sm-D1
  • SMD1
  • snprd1
  • snrnpd1
  • SNRPD
  • SNRPD2
  • wu:fk26a01
  • zgc:86929

Gene-IDs for different species

GENE IDSPECIES
6632 Homo sapiens
480178 Canis lupus familiaris
20641 Mus musculus
291794 Rattus norvegicus
192331 Danio rerio
443747 Xenopus laevis
508788 Bos taurus
100718697 Cavia porcellus

Protein level used designations for SNRPD1

  • Sm-D autoantigen
  • small nuclear ribonucleoprotein D1 polypeptide 16kDa pseudogene
  • small nuclear ribonucleoprotein Sm D1
  • snRNP core protein D1
  • small nuclear ribonucleoprotein D2 polypeptide 16.5kDa
  • sm-D autoantigen
  • sm-D1
Other products related to SNRPD1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com