SPG21 (Spastic Paraplegia 21, SPG21)

Short Description: The protein encoded by this gene was identified by a two-hybrid screen using CD4 as the bait. It binds to the hydrophobic C-terminal amino acids of CD4 which are involved in repression of T cell activation. The interaction with CD4 is mediated by the noncatalytic alpha/beta hydrolase fold domain of this protein. It is thus proposed that this gene product modulates the stimulatory activity of CD4. At least three different transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008].
More information related to gene SPG21.
Products related to SPG21 Gene:
152 Products
Type
  • 146
  • 6
Species
  • 68
  • 47
  • 28
  • 4
  • 2
Application
  • 95
  • 34
  • 25
  • 16
  • 2
Fusion tag
  • 52
  • 22
  • 16
  • 13
  • 8
Vector Backbone
  • 10
  • 10
  • 8
  • 8
  • 6
Vector
  • 65
  • 44
  • 12
  • 11
  • 9
Insert
  • 59
  • 50
  • 21
  • 8
  • 6
Oligo-Type
  • 4
  • 2
Resistance Gene
  • 62
  • 53
  • 28
  • 3
  • 2
Expression Type
  • 104
  • 54
  • 26
Selectable Marker
  • 39
  • 26
  • 26
  • 1
Promoter
  • 44
  • 42
  • 31
  • 12
  • 8
Format
  • 76
  • 26
  • 26
  • 24

Type:
ORF
Application:
Protein Expression
Gene:
Spastic Paraplegia 21 (SPG21)
NCBI Accession:
NM_016630,NP_057714
Species:
Human
Synonyms:
SPG21, Spg21, spg21.S, spg21
Insert length:
927 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5337657
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Spastic Paraplegia 21 (SPG21)
Gene ID:
406704 (Zebrafish (Danio rerio), SPG21)
Synonyms:
SPG21, Spg21, spg21.S, spg21
Vector type:
Cloning Vector
Vector backbone:
pBluescript SK-
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3468713
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Spastic Paraplegia 21 (SPG21)
Gene ID:
734314 (Xenopus laevis, SPG21)
Synonyms:
SPG21, Spg21, spg21.S, spg21
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3868454
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Spastic Paraplegia 21 (SPG21)
Gene ID:
549880 (Xenopus tropicalis, SPG21)
Synonyms:
SPG21, Spg21, spg21.S, spg21
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4022524
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Spastic Paraplegia 21 (SPG21)
Gene ID:
549880 (Xenopus tropicalis, SPG21)
Synonyms:
SPG21, Spg21, spg21.S, spg21
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4022525
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Spastic Paraplegia 21 (SPG21)
Gene ID:
27965 (Mouse (Murine), SPG21)
Synonyms:
SPG21, Spg21, spg21.S, spg21
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4046068
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Spastic Paraplegia 21 (SPG21)
Gene ID:
300791 (Rat (Rattus), SPG21)
Synonyms:
SPG21, Spg21, spg21.S, spg21
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4051593
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Spastic Paraplegia 21 (SPG21)
Gene ID:
51324 (Human, SPG21)
Synonyms:
SPG21, Spg21, spg21.S, spg21
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4090990
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Spastic Paraplegia 21 (SPG21)
Gene ID:
404069 (Cow (Bovine), SPG21)
Synonyms:
SPG21, Spg21, spg21.S, spg21
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4057163
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Spastic Paraplegia 21 (SPG21)
Gene ID:
27965 (Mouse (Murine), SPG21)
Synonyms:
SPG21, Spg21, spg21.S, spg21
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4004987
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Spastic Paraplegia 21 (SPG21)
Gene ID:
27965 (Mouse (Murine), SPG21)
Synonyms:
SPG21, Spg21, spg21.S, spg21
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4004988
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Spastic Paraplegia 21 (SPG21)
NCBI Accession:
NM_138584
Species:
Mouse (Murine)
Synonyms:
SPG21, Spg21, spg21.S, spg21
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3591605
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Spastic Paraplegia 21 (SPG21)
NCBI Accession:
NM_016630
Species:
Human
Synonyms:
SPG21, Spg21, spg21.S, spg21
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3591606
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Spastic Paraplegia 21
Species:
Mouse (Murine)
Synonyms:
ACP33, GL010, MAST, BM-019, C78576, D9Wsu18e, Maspardin, wu:fd07h02, zgc:73091
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3194313
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Spastic Paraplegia 21
Species:
Human
Synonyms:
ACP33, GL010, MAST, BM-019, C78576, D9Wsu18e, Maspardin, wu:fd07h02, zgc:73091
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3188874
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Spastic Paraplegia 21 (SPG21)
Gene ID:
734314 (Xenopus laevis, SPG21)
Synonyms:
SPG21, Spg21, spg21.S, spg21
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3868453
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Spastic Paraplegia 21 (SPG21)
Gene ID:
549880 (Xenopus tropicalis, SPG21)
Synonyms:
SPG21, Spg21, spg21.S, spg21
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4022526
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Spastic Paraplegia 21 (SPG21)
Gene ID:
549880 (Xenopus tropicalis, SPG21)
Synonyms:
SPG21, Spg21, spg21.S, spg21
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4022527
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Spastic Paraplegia 21 (SPG21)
Gene ID:
27965 (Mouse (Murine), SPG21)
Synonyms:
SPG21, Spg21, spg21.S, spg21
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4046067
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Spastic Paraplegia 21 (SPG21)
Gene ID:
300791 (Rat (Rattus), SPG21)
Synonyms:
SPG21, Spg21, spg21.S, spg21
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4051592
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to SPG21

  • SPG21, maspardin (SPG21)
  • SPG21, maspardin (Spg21)
  • spastic paraplegia 21 (autosomal recessive, Mast syndrome) (SPG21)
  • SPG21, maspardin S homeolog (spg21.S)
  • spastic paraplegia 21 (autosomal recessive, Mast syndrome) (spg21)
  • ACP33
  • BM-019
  • C78576
  • D9Wsu18e
  • GL010
  • Maspardin
  • MAST
  • wu:fd07h02
  • zgc:73091

Gene-IDs for different species

GENE IDSPECIES
51324 Homo sapiens
404069 Bos taurus
100358285 Oryctolagus cuniculus
27965 Mus musculus
300791 Rattus norvegicus
415526 Gallus gallus
487599 Canis lupus familiaris
100514084 Sus scrofa
734314 Xenopus laevis
100174603 Pongo abelii
406704 Danio rerio
100713790 Cavia porcellus

Protein level used designations for SPG21

  • acid cluster protein 33
  • maspardin
  • spastic paraplegia 21 autosomal recessive Mast syndrome protein homolog
  • spastic paraplegia 21
  • spastic paraplegia 21 homolog
  • spastic paraplegia 21, maspardin (autosomal recessive, Mast syndrome)
  • spastic paraplegia 21 (autosomal recessive, Mast syndrome)
Other products related to SPG21 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com