SRC (V-Src Sarcoma (Schmidt-Ruppin A-2) Viral Oncogene Homolog (Avian), SRC)

Short Description: This gene is highly similar to the v-src gene of Rous sarcoma virus. This proto-oncogene may play a role in the regulation of embryonic development and cell growth. The protein encoded by this gene is a tyrosine-protein kinase whose activity can be inhibited by phosphorylation by c-SRC kinase. Mutations in this gene could be involved in the malignant progression of colon cancer. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008].
More information related to gene SRC.
Products related to SRC Gene:
166 Products
Data Quality
  • 3
  • 3
Type
  • 161
  • 5
Species
  • 67
  • 66
  • 27
  • 4
  • 2
Application
  • 110
  • 35
  • 22
  • 16
  • 2
Fusion tag
  • 51
  • 21
  • 18
  • 15
  • 10
Vector Backbone
  • 10
  • 10
  • 6
  • 6
  • 6
Vector
  • 77
  • 42
  • 18
  • 9
  • 8
Insert
  • 72
  • 54
  • 19
  • 8
  • 6
Oligo-Type
  • 3
  • 2
Resistance Gene
  • 83
  • 42
  • 30
  • 6
  • 2
Expression Type
  • 112
  • 53
  • 38
Selectable Marker
  • 38
  • 31
  • 24
  • 1
Promoter
  • 52
  • 44
  • 31
  • 21
  • 8
Format
  • 85
  • 38
  • 25
  • 18

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
V-Src Sarcoma (Schmidt-Ruppin A-2) Viral Oncogene Homolog (Avian) (SRC)
Gene ID:
6714 (Human, SRC)
Synonyms:
SRC, LOC5574802, CpipJ_CPIJ010659, Src, Src64B
Vector type:
Mammalian Expression Vector
Vector backbone:
pTCN
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • 3-1291
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4098087
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
V-Src Sarcoma (Schmidt-Ruppin A-2) Viral Oncogene Homolog (Avian) (SRC)
Gene ID:
380430 (Xenopus laevis, SRC)
Synonyms:
SRC, LOC5574802, CpipJ_CPIJ010659, Src, Src64B
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3844245
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
V-Src Sarcoma (Schmidt-Ruppin A-2) Viral Oncogene Homolog (Avian) (SRC)
Gene ID:
6714 (Human, SRC)
Synonyms:
SRC, LOC5574802, CpipJ_CPIJ010659, Src, Src64B
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4086956
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
V-Src Sarcoma (Schmidt-Ruppin A-2) Viral Oncogene Homolog (Avian) (SRC)
Gene ID:
6714 (Human, SRC)
Synonyms:
SRC, LOC5574802, CpipJ_CPIJ010659, Src, Src64B
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4086957
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
V-Src Sarcoma (Schmidt-Ruppin A-2) Viral Oncogene Homolog (Avian) (SRC)
Gene ID:
373647 (Xenopus laevis, SRC)
Synonyms:
SRC, LOC5574802, CpipJ_CPIJ010659, Src, Src64B
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4056361
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
V-Src Sarcoma (Schmidt-Ruppin A-2) Viral Oncogene Homolog (Avian) (SRC)
NCBI Accession:
NM_005417
Species:
Human
Synonyms:
SRC, LOC5574802, CpipJ_CPIJ010659, Src, Src64B
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3592464
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
V-Src Sarcoma (Schmidt-Ruppin A-2) Viral Oncogene Homolog (Avian) (SRC)
NCBI Accession:
NM_009271
Species:
Mouse (Murine)
Synonyms:
SRC, LOC5574802, CpipJ_CPIJ010659, Src, Src64B
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3592463
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
V-Src Sarcoma (Schmidt-Ruppin A-2) Viral Oncogene Homolog (Avian) (SRC)
NCBI Accession:
NM_001025395
Species:
Mouse (Murine)
Synonyms:
SRC, LOC5574802, CpipJ_CPIJ010659, Src, Src64B
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3592465
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
V-Src Sarcoma (Schmidt-Ruppin A-2) Viral Oncogene Homolog (Avian)
Species:
Human
Synonyms:
AW259666, pp60c-src, C-src1, CG7524, D-Src64B, D-src, DSRC64, DSrc, DSrc64, DSrc64B, Dm SRC1, DmHD-358, Dmel\CG7524, Dsrc, Dsrc64, Dsrc64B, HD-358, MRE5, SRC 64B, Src, Src1, Src64, c-src, dSrc, dsrc, src, src1, src64, src64B, src64b, ASV, SRC1, c-SRC, p60-Src, c-Src, PP60C-SCR, SDR
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3189020
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
V-Src Sarcoma (Schmidt-Ruppin A-2) Viral Oncogene Homolog (Avian)
Species:
Mouse (Murine)
Synonyms:
AW259666, pp60c-src, C-src1, CG7524, D-Src64B, D-src, DSRC64, DSrc, DSrc64, DSrc64B, Dm SRC1, DmHD-358, Dmel\CG7524, Dsrc, Dsrc64, Dsrc64B, HD-358, MRE5, SRC 64B, Src, Src1, Src64, c-src, dSrc, dsrc, src, src1, src64, src64B, src64b, ASV, SRC1, c-SRC, p60-Src, c-Src, PP60C-SCR, SDR
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3193890
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
ORF
Application:
Cloning
Gene:
V-Src Sarcoma (Schmidt-Ruppin A-2) Viral Oncogene Homolog (Avian) (SRC)
Species:
Human
Synonyms:
SRC, LOC5574802, CpipJ_CPIJ010659, Src, Src64B
Insert length:
1611 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5755095
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
V-Src Sarcoma (Schmidt-Ruppin A-2) Viral Oncogene Homolog (Avian) (SRC)
Gene ID:
380430 (Xenopus laevis, SRC)
Synonyms:
SRC, LOC5574802, CpipJ_CPIJ010659, Src, Src64B
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3844246
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
V-Src Sarcoma (Schmidt-Ruppin A-2) Viral Oncogene Homolog (Avian) (SRC)
Gene ID:
6714 (Human, SRC)
Synonyms:
SRC, LOC5574802, CpipJ_CPIJ010659, Src, Src64B
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4086955
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
V-Src Sarcoma (Schmidt-Ruppin A-2) Viral Oncogene Homolog (Avian) (SRC)
Gene ID:
6714 (Human, SRC)
Synonyms:
SRC, LOC5574802, CpipJ_CPIJ010659, Src, Src64B
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4086958
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
V-Src Sarcoma (Schmidt-Ruppin A-2) Viral Oncogene Homolog (Avian) (SRC)
Gene ID:
373647 (Xenopus laevis, SRC)
Synonyms:
SRC, LOC5574802, CpipJ_CPIJ010659, Src, Src64B
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4056362
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
V-Src Sarcoma (Schmidt-Ruppin A-2) Viral Oncogene Homolog (Avian) (SRC)
Gene ID:
6714 (Human, SRC)
Synonyms:
SRC, LOC5574802, CpipJ_CPIJ010659, Src, Src64B
Insert length:
1611 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5319378
$204.60
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
V-Src Sarcoma (Schmidt-Ruppin A-2) Viral Oncogene Homolog (Avian) (SRC)
NCBI Accession:
NM_005417,NP_005408
Species:
Human
Synonyms:
SRC, LOC5574802, CpipJ_CPIJ010659, Src, Src64B
Insert length:
5500 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • Chellappa, Jankova, Schnabl, Pan, Brelivet, Fung, Chan, Dent, Clarke, Robertson, Sladek: "Src tyrosine kinase phosphorylation of nuclear receptor HNF4α correlates with isoform-specific loss of HNF4α in human colon cancer." in: Proceedings of the National Academy of Sciences of the United States of America, Vol. 109, Issue 7, pp. 2302-7, 2012 (Pubmed)
  • Bögel, Gujdár, Geiszt, Lányi, Fekete, Sipeki, Downward, Buday: "Frank-ter Haar syndrome protein Tks4 regulates epidermal growth factor-dependent cell migration." in: The Journal of biological chemistry, Vol. 287, Issue 37, pp. 31321-9, 2012 (Pubmed)
Catalog No. ABIN3381815
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
V-Src Sarcoma (Schmidt-Ruppin A-2) Viral Oncogene Homolog (Avian) (SRC)
Species:
Human
Synonyms:
SRC, LOC5574802, CpipJ_CPIJ010659, Src, Src64B
Insert length:
1611 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4481600
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
V-Src Sarcoma (Schmidt-Ruppin A-2) Viral Oncogene Homolog (Avian) (SRC)
Species:
Human
Synonyms:
SRC, LOC5574802, CpipJ_CPIJ010659, Src, Src64B
Insert length:
1611 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4416514
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
V-Src Sarcoma (Schmidt-Ruppin A-2) Viral Oncogene Homolog (Avian) (SRC)
Species:
Human
Synonyms:
SRC, LOC5574802, CpipJ_CPIJ010659, Src, Src64B
Insert length:
1611 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4625071
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to SRC

  • SRC proto-oncogene, non-receptor tyrosine kinase (SRC)
  • uncharacterized LOC5574802 (LOC5574802)
  • proto-oncogene tyrosine-protein kinase src (CpipJ_CPIJ010659)
  • Rous sarcoma oncogene (Src)
  • Src oncogene at 64B (Src64B)
  • SRC proto-oncogene, non-receptor tyrosine kinase (Src)
  • ASV
  • AW259666
  • c-src
  • c-Src
  • c-SRC
  • C-src1
  • CG7524
  • D-src
  • D-Src64B
  • Dmel\CG7524
  • DmHD-358
  • Dm SRC1
  • dsrc
  • dSrc
  • Dsrc
  • DSrc
  • DSRC64
  • Dsrc64
  • DSrc64
  • DSrc64B
  • Dsrc64B
  • HD-358
  • MRE5
  • p60-Src
  • PP60C-SCR
  • pp60c-src
  • SDR
  • Src
  • src
  • src1
  • SRC1
  • Src1
  • src64
  • Src64
  • src64B
  • src64b
  • SRC 64B

Gene-IDs for different species

GENE IDSPECIES
458229 Pan troglodytes
5574802 Aedes aegypti
6043642 Culex quinquefasciatus
20779 Mus musculus
48973 Drosophila melanogaster
6714 Homo sapiens
83805 Rattus norvegicus
485864 Canis lupus familiaris
535742 Bos taurus
100154503 Sus scrofa
396442 Gallus gallus

Protein level used designations for SRC

  • proto-oncogene tyrosine-protein kinase SRC
  • proto-oncogene tyrosine-protein kinase src
  • neuronal proto-oncogene tyrosine-protein kinase Src
  • p60-Src
  • proto-oncogene c-Src
  • CG7524-PB
  • CG7524-PC
  • CG7524-PD
  • CG7524-PE
  • CG7524-PF
  • CG7524-PG
  • CG7524-PH
  • CG7524-PI
  • CG7524-PJ
  • Src proto oncogene sequence
  • Src64B-PB
  • Src64B-PC
  • Src64B-PD
  • Src64B-PE
  • Src64B-PF
  • Src64B-PG
  • Src64B-PH
  • Src64B-PI
  • Src64B-PJ
  • mRNA-like ncRNA in embryogenesis 5
  • proto-oncogene tyrosine-protein kinase Src
  • protooncogene SRC, Rous sarcoma
  • tyrosine kinase pp60c-src
  • tyrosine-protein kinase SRC-1
  • Rous sarcoma oncogene
  • c-Src
  • pp60c-src
  • tyrosine protein kinase c-src
  • tyrosine protein kinase pp60-c-src
  • v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog
  • src oncogene
  • v-src avian sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog
  • non-tyrosine protein kinase
Other products related to SRC such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com