SSTR4 (Somatostatin Receptor 4, SSTR4)

Short Description: Somatostatin acts at many sites to inhibit the release of many hormones and other secretory proteins. The biologic effects of somatostatin are probably mediated by a family of G protein-coupled receptors that are expressed in a tissue-specific manner. SSTR4 is a member of the superfamily of receptors having seven transmembrane segments and is expressed in highest levels in fetal and adult brain and lung. [provided by RefSeq, Jul 2008].
More information related to gene SSTR4.
Products related to SSTR4 Gene:
Type
  • 103
  • 2
Species
  • 49
  • 30
  • 26
Application
  • 49
  • 32
  • 20
  • 16
Fusion tag
  • 37
  • 13
  • 12
  • 10
  • 8
Vector Backbone
  • 8
  • 6
  • 6
  • 6
  • 6
Vector
  • 36
  • 25
  • 16
  • 14
  • 9
Insert
  • 45
  • 24
  • 18
  • 8
  • 6
Oligo-Type
  • 2
Resistance Gene
  • 39
  • 39
  • 18
  • 7
  • 2
Expression Type
  • 90
  • 51
Selectable Marker
  • 34
  • 26
  • 1
Promoter
  • 32
  • 28
  • 17
  • 8
  • 6
Format
  • 36
  • 31
  • 22
  • 16
105 Products

Type:
cDNA
Application:
Cloning
Gene:
Somatostatin Receptor 4 (SSTR4)
Gene ID:
20608 (Mouse (Murine), SSTR4)
Synonyms:
SSTR4, Sstr4
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4003847
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Somatostatin Receptor 4 (SSTR4)
Gene ID:
20608 (Mouse (Murine), SSTR4)
Synonyms:
SSTR4, Sstr4
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4003848
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Somatostatin Receptor 4 (SSTR4)
Gene ID:
6754 (Human, SSTR4)
Synonyms:
SSTR4, Sstr4
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4000433
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Somatostatin Receptor 4 (SSTR4)
Gene ID:
6754 (Human, SSTR4)
Synonyms:
SSTR4, Sstr4
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4000434
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Somatostatin Receptor 4 (SSTR4)
Gene ID:
6754 (Human, SSTR4)
Synonyms:
SSTR4, Sstr4
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4098268
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Somatostatin Receptor 4 (SSTR4)
Gene ID:
20608 (Mouse (Murine), SSTR4)
Synonyms:
SSTR4, Sstr4
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4003845
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Somatostatin Receptor 4 (SSTR4)
Gene ID:
20608 (Mouse (Murine), SSTR4)
Synonyms:
SSTR4, Sstr4
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4003846
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Somatostatin Receptor 4 (SSTR4)
Gene ID:
6754 (Human, SSTR4)
Synonyms:
SSTR4, Sstr4
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4000435
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Somatostatin Receptor 4 (SSTR4)
Gene ID:
6754 (Human, SSTR4)
Synonyms:
SSTR4, Sstr4
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4000436
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Somatostatin Receptor 4 (SSTR4)
Gene ID:
6754 (Human, SSTR4)
Synonyms:
SSTR4, Sstr4
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4098269
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Somatostatin Receptor 4 (SSTR4)
Gene ID:
6754 (Human, SSTR4)
Synonyms:
SSTR4, Sstr4
Insert length:
1167 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5323982
$189.37
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
ORF
Application:
Cloning
Gene:
Somatostatin Receptor 4 (SSTR4)
Gene ID:
6754 (Human, SSTR4)
Synonyms:
SSTR4, Sstr4
Insert length:
1167 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5323994
$189.37
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Somatostatin Receptor 4 (SSTR4)
Species:
Human
Synonyms:
SSTR4, Sstr4
Insert length:
1167 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-N-D-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4513084
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Somatostatin Receptor 4 (SSTR4)
Gene ID:
6754 (Human, SSTR4)
Synonyms:
SSTR4, Sstr4
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3414844
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Somatostatin Receptor 4 (SSTR4)
NCBI Accession:
NM_001052,NP_001043
Species:
Human
Synonyms:
SSTR4, Sstr4
Insert length:
1920 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL4
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948183

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3381819
$310.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Somatostatin Receptor 4 (SSTR4)
NCBI Accession:
NM_013036,NP_037168
Species:
Rat (Rattus)
Synonyms:
SSTR4, Sstr4
Insert length:
1155 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3372245
$420.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Somatostatin Receptor 4 (SSTR4)
NCBI Accession:
NM_001052
Species:
Human
Synonyms:
SSTR4, Sstr4
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of SSTR4
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5111239
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Somatostatin Receptor 4 (SSTR4)
NCBI Accession:
NM_009219
Species:
Mouse (Murine)
Synonyms:
SSTR4, Sstr4
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Sstr4
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5111241
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Somatostatin Receptor 4 (SSTR4)
NCBI Accession:
NM_013036
Species:
Rat (Rattus)
Synonyms:
SSTR4, Sstr4
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Sstr4
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5111243
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
ORF
Application:
Protein Expression
Gene:
Somatostatin Receptor 4 (SSTR4)
NCBI Accession:
NM_001052,NP_001043
Species:
Human
Synonyms:
SSTR4, Sstr4
Insert length:
1167 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5388201
$420.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days
  • <
  • 1

Synonyms and alternative names related to SSTR4

  • somatostatin receptor 4 (SSTR4)
  • somatostatin receptor 4 (Sstr4)
  • LOC100303655
  • Smstr4
  • SS-4-R
  • SS4-R
  • SS4R
  • sst4
  • SSTR4

Gene-IDs for different species

GENE IDSPECIES
428547 Gallus gallus
469897 Pan troglodytes
702017 Macaca mulatta
100303655 Papio anubis
100352400 Oryctolagus cuniculus
6754 Homo sapiens
20608 Mus musculus
25555 Rattus norvegicus

Protein level used designations for SSTR4

  • somatostatin receptor type 4
  • somatostatin receptor 4
  • G-protein coupled receptor
  • SS-4-R
  • SS4-R
  • SS4R
  • Somatostatin receptor subtype 4 Rattus norvegicus Sprague-Dawley major hippocampal somatostatin receptor (SSTR4) mRNA
Other products related to SSTR4 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com