STAT6 (Signal Transducer and Activator of Transcription 6, Interleukin-4 Induced, STAT6)

Short Description: The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein plays a central role in exerting IL4 mediated biological responses. It is found to induce the expression of BCL2L1/BCL-X(L), which is responsible for the anti-apoptotic activity of IL4. Knockout studies in mice suggested the roles of this gene in differentiation of T helper 2 (Th2) cells, expression of cell surface markers, and class switch of immunoglobulins. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010].
More information related to gene STAT6.
Products related to STAT6 Gene:
161 Products
Data Quality
  • 1
Type
  • 156
  • 5
Species
  • 73
  • 43
  • 41
  • 2
  • 2
Application
  • 109
  • 27
  • 23
  • 16
  • 2
Fusion tag
  • 46
  • 23
  • 18
  • 15
  • 9
Vector Backbone
  • 10
  • 10
  • 8
  • 6
  • 6
Vector
  • 79
  • 44
  • 12
  • 9
  • 9
Insert
  • 78
  • 42
  • 20
  • 8
  • 6
Oligo-Type
  • 3
  • 2
Resistance Gene
  • 75
  • 50
  • 26
  • 5
  • 2
Expression Type
  • 108
  • 55
  • 39
Selectable Marker
  • 39
  • 32
  • 26
  • 2
  • 1
Promoter
  • 53
  • 47
  • 30
  • 17
  • 8
Format
  • 98
  • 27
  • 22
  • 14

Type:
ORF
Application:
Cloning
Gene:
Signal Transducer and Activator of Transcription 6, Interleukin-4 Induced (STAT6)
Species:
Human
Synonyms:
STAT6, Stat6, LOC100859543
Insert length:
2544 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5728134
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Signal Transducer and Activator of Transcription 6, Interleukin-4 Induced (STAT6)
Gene ID:
337413 (Zebrafish (Danio rerio), STAT6)
Synonyms:
STAT6, Stat6, LOC100859543
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4017081
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Signal Transducer and Activator of Transcription 6, Interleukin-4 Induced (STAT6)
Gene ID:
6778 (Human, STAT6)
Synonyms:
STAT6, Stat6, LOC100859543
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3805512
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Signal Transducer and Activator of Transcription 6, Interleukin-4 Induced (STAT6)
Gene ID:
495683 (Xenopus laevis, STAT6)
Synonyms:
STAT6, Stat6, LOC100859543
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3853587
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Signal Transducer and Activator of Transcription 6, Interleukin-4 Induced (STAT6)
Gene ID:
20852 (Mouse (Murine), STAT6)
Synonyms:
STAT6, Stat6, LOC100859543
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3988702
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Signal Transducer and Activator of Transcription 6, Interleukin-4 Induced (STAT6)
NCBI Accession:
NM_001044250
Species:
Rat (Rattus)
Synonyms:
STAT6, Stat6, LOC100859543
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3594223
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Signal Transducer and Activator of Transcription 6, Interleukin-4 Induced (STAT6)
Species:
Human
Synonyms:
STAT6, Stat6, LOC100859543
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3594221
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Signal Transducer and Activator of Transcription 6, Interleukin-4 Induced (STAT6)
NCBI Accession:
NM_009284
Species:
Mouse (Murine)
Synonyms:
STAT6, Stat6, LOC100859543
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3594222
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Signal Transducer and Activator of Transcription 6, Interleukin-4 Induced
Species:
Human
Synonyms:
D12S1644, IL-4-STAT, STAT6B, STAT6C
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3190672
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Signal Transducer and Activator of Transcription 6, Interleukin-4 Induced
Species:
Rat (Rattus)
Synonyms:
D12S1644, IL-4-STAT, STAT6B, STAT6C
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3197316
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Signal Transducer and Activator of Transcription 6, Interleukin-4 Induced (STAT6)
Gene ID:
337413 (Zebrafish (Danio rerio), STAT6)
Synonyms:
STAT6, Stat6, LOC100859543
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4017082
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Signal Transducer and Activator of Transcription 6, Interleukin-4 Induced (STAT6)
Gene ID:
6778 (Human, STAT6)
Synonyms:
STAT6, Stat6, LOC100859543
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3805511
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Signal Transducer and Activator of Transcription 6, Interleukin-4 Induced (STAT6)
Gene ID:
495683 (Xenopus laevis, STAT6)
Synonyms:
STAT6, Stat6, LOC100859543
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3853588
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Signal Transducer and Activator of Transcription 6, Interleukin-4 Induced (STAT6)
Gene ID:
20852 (Mouse (Murine), STAT6)
Synonyms:
STAT6, Stat6, LOC100859543
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3988703
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Signal Transducer and Activator of Transcription 6, Interleukin-4 Induced (STAT6)
Gene ID:
6778 (Human, STAT6)
Synonyms:
STAT6, Stat6, LOC100859543
Insert length:
2544 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5322206
$214.67
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Signal Transducer and Activator of Transcription 6, Interleukin-4 Induced (STAT6)
NCBI Accession:
NM_003153,NP_003144
Species:
Human
Synonyms:
STAT6, Stat6, LOC100859543
Insert length:
3460 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Publications
  • White, Martin, Abe, Marroquin, Stern, Fu: "Insulin receptor substrate-1/2 mediates IL-4-induced migration of human airway epithelial cells." in: American journal of physiology. Lung cellular and molecular physiology, Vol. 297, Issue 1, pp. L164-73, 2009 (Pubmed)
Catalog No. ABIN3387017
$300.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Signal Transducer and Activator of Transcription 6, Interleukin-4 Induced (STAT6)
Species:
Human
Synonyms:
STAT6, Stat6, LOC100859543
Insert length:
2544 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-N-His
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His tag
Expression:
Transient

Sequencing Primer:
  • T7 promoter primer: 5'-TAATACGACTCACTATAGGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4625176
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Signal Transducer and Activator of Transcription 6, Interleukin-4 Induced (STAT6)
Species:
Human
Synonyms:
STAT6, Stat6, LOC100859543
Insert length:
2544 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4416619
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Signal Transducer and Activator of Transcription 6, Interleukin-4 Induced (STAT6)
Species:
Human
Synonyms:
STAT6, Stat6, LOC100859543
Insert length:
2544 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-N-D-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4513171
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Signal Transducer and Activator of Transcription 6, Interleukin-4 Induced (STAT6)
Species:
Human
Synonyms:
STAT6, Stat6, LOC100859543
Insert length:
2544 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4481705
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days
  • <
  • 1

Synonyms and alternative names related to STAT6

  • signal transducer and activator of transcription 6 (STAT6)
  • signal transducer and activator of transcription 6 (Stat6)
  • signal transducer and activator of transcription 6-like (LOC100859543)
  • D12S1644
  • IL-4-STAT
  • STAT6B
  • STAT6C

Gene-IDs for different species

GENE IDSPECIES
100050053 Equus caballus
20852 Mus musculus
100859543 Gallus gallus
6778 Homo sapiens
100142679 Canis lupus familiaris
362896 Rattus norvegicus
100153518 Sus scrofa
353105 Bos taurus
100344264 Oryctolagus cuniculus
100726686 Cavia porcellus

Protein level used designations for STAT6

  • signal transducer and transcription activator 6
  • STAT, interleukin4-induced
  • signal transducer and activator of transcription 6
  • transcription factor IL-4 STAT
Other products related to STAT6 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com