TACR1 (Tachykinin Receptor 1, TACR1)

Short Description: This gene belongs to a gene family of tachykinin receptors. These tachykinin receptors are characterized by interactions with G proteins and contain seven hydrophobic transmembrane regions. This gene encodes the receptor for the tachykinin substance P, also referred to as neurokinin 1. The encoded protein is also involved in the mediation of phosphatidylinositol metabolism of substance P. [provided by RefSeq, Sep 2008].
More information related to gene TACR1.
Products related to TACR1 Gene:
109 Products
Type
  • 105
  • 4
Species
  • 50
  • 30
  • 27
  • 2
Application
  • 57
  • 25
  • 25
  • 20
Fusion tag
  • 40
  • 19
  • 13
  • 9
  • 8
Vector Backbone
  • 8
  • 8
  • 8
  • 8
  • 6
Vector
  • 43
  • 29
  • 12
  • 11
  • 9
Insert
  • 37
  • 27
  • 21
  • 10
  • 8
Oligo-Type
  • 4
Resistance Gene
  • 45
  • 34
  • 22
  • 4
  • 2
Expression Type
  • 96
  • 55
Selectable Marker
  • 32
  • 28
Promoter
  • 38
  • 35
  • 14
  • 10
  • 8
Format
  • 39
  • 28
  • 27
  • 15

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Tachykinin Receptor 1 (TACR1)
Gene ID:
100127678 (Xenopus tropicalis, TACR1)
Synonyms:
TACR1, Tacr1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3873247
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Tachykinin Receptor 1 (TACR1)
Gene ID:
6869 (Human, TACR1)
Synonyms:
TACR1, Tacr1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4000461
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Tachykinin Receptor 1 (TACR1)
Gene ID:
6869 (Human, TACR1)
Synonyms:
TACR1, Tacr1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4000462
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Tachykinin Receptor 1 (TACR1)
Gene ID:
100127678 (Xenopus tropicalis, TACR1)
Synonyms:
TACR1, Tacr1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3873246
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Tachykinin Receptor 1 (TACR1)
Gene ID:
6869 (Human, TACR1)
Synonyms:
TACR1, Tacr1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4000463
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Tachykinin Receptor 1 (TACR1)
Gene ID:
6869 (Human, TACR1)
Synonyms:
TACR1, Tacr1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4000464
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Tachykinin Receptor 1 (TACR1)
Gene ID:
6869 (Human, TACR1)
Synonyms:
TACR1, Tacr1
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3413466
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Tachykinin Receptor 1 (TACR1)
NCBI Accession:
NM_012667,NP_036799
Species:
Rat (Rattus)
Synonyms:
TACR1, Tacr1
Insert length:
1224 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3376196
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Tachykinin Receptor 1 (TACR1)
NCBI Accession:
NM_001058,NP_001049
Species:
Human
Synonyms:
TACR1, Tacr1
Insert length:
1224 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5366933
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Tachykinin Receptor 1 (TACR1)
NCBI Accession:
NM_015727,NP_056542
Species:
Human
Synonyms:
TACR1, Tacr1
Insert length:
936 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5366934
$410.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Tachykinin Receptor 1 (TACR1)
NCBI Accession:
NM_012667,NP_036799
Species:
Rat (Rattus)
Synonyms:
TACR1, Tacr1
Insert length:
1224 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5366935
$410.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Application:
RNA Interference
Gene:
Tachykinin Receptor 1
Species:
Human
Synonyms:
NK1R, NKIR, SPR, TAC1R, Nk1r, Spr, Tac1r, nk1R, Tacr1, ASPR
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • TACR1 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3344462
$420.00
1 kit
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Application:
RNA Interference
Gene:
Tachykinin Receptor 1
Species:
Mouse (Murine)
Synonyms:
NK1R, NKIR, SPR, TAC1R, Nk1r, Spr, Tac1r, nk1R, Tacr1, ASPR
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Tacr1 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3269610
$420.00
1 kit
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Application:
RNA Interference
Gene:
Tachykinin Receptor 1
Species:
Rat (Rattus)
Synonyms:
NK1R, NKIR, SPR, TAC1R, Nk1r, Spr, Tac1r, nk1R, Tacr1, ASPR
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Tacr1 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3353723
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Tachykinin Receptor 1 (TACR1)
Species:
Human
Synonyms:
TACR1, Tacr1
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of TACR1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5098959
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Tachykinin Receptor 1 (TACR1)
NCBI Accession:
NM_009313
Species:
Mouse (Murine)
Synonyms:
TACR1, Tacr1
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Tacr1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5098963
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Tachykinin Receptor 1 (TACR1)
NCBI Accession:
NM_012667
Species:
Rat (Rattus)
Synonyms:
TACR1, Tacr1
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Tacr1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5098965
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Tachykinin Receptor 1 (TACR1)
NCBI Accession:
NM_015727
Species:
Human
Synonyms:
TACR1, Tacr1
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of TACR1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5098961
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Tachykinin Receptor 1 (TACR1)
Gene ID:
6869 (Human, TACR1)
Synonyms:
TACR1, Tacr1
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter, U6 Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Viral particles:
ABIN5061386

Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5042441
$503.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Tachykinin Receptor 1
Gene ID:
6869 (Human, TACR1)
Synonyms:
NK1R, NKIR, SPR, TAC1R, Nk1r, Spr, Tac1r, nk1R, Tacr1, ASPR
Purification:
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
Components:
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5785982
$516.85
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to TACR1

  • tachykinin receptor 1 (TACR1)
  • tachykinin receptor 1 (Tacr1)
  • ASPR
  • NK1R
  • Nk1r
  • nk1R
  • NKIR
  • SPR
  • Spr
  • TAC1R
  • Tac1r
  • Tacr1

Gene-IDs for different species

GENE IDSPECIES
100053491 Equus caballus
6869 Homo sapiens
21336 Mus musculus
24807 Rattus norvegicus
403815 Canis lupus familiaris
407133 Bos taurus
100357296 Oryctolagus cuniculus
100135626 Cavia porcellus
395677 Gallus gallus
101122011 Ovis aries

Protein level used designations for TACR1

  • NK-1 receptor
  • NK-1R
  • substance-P receptor
  • tachykinin receptor 1 (substance P receptor; neurokinin-1 receptor)
  • Nk1 receptor
  • neurokinin receptor 1
  • substance P receptor
  • SPR
  • neurokinin 1 receptor
  • substance p receptor
  • neurokinin receptor subtype NK1
  • tachikinin receptor 1
  • tachykinin receptor 1
  • neurokinin-1 receptor
Other products related to TACR1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com