TGFB2 (Transforming Growth Factor, beta 2, TGFB2)

Short Description: This gene encodes a member of the transforming growth factor beta (TGFB) family of cytokines, which are multifunctional peptides that regulate proliferation, differentiation, adhesion, migration, and other functions in many cell types by transducing their signal through combinations of transmembrane type I and type II receptors (TGFBR1 and TGFBR2) and their downstream effectors, the SMAD proteins. Disruption of the TGFB/SMAD pathway has been implicated in a variety of human cancers. The encoded protein is secreted and has suppressive effects of interleukin-2 dependent T-cell growth. Translocation t(1\;7)(q41\;p21) between this gene and HDAC9 is associated with Peters' anomaly, a congenital defect of the anterior chamber of the eye. The knockout mice lacking this gene show perinatal mortality and a wide range of developmental, including cardiac, defects. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Sep 2010].
More information related to gene TGFB2.
Products related to TGFB2 Gene:
154 Products
Data Quality
  • 5
Type
  • 147
  • 7
Species
  • 57
  • 46
  • 39
  • 12
Application
  • 102
  • 25
  • 24
  • 16
  • 3
Fusion tag
  • 41
  • 21
  • 17
  • 15
  • 11
Vector Backbone
  • 10
  • 10
  • 6
  • 6
  • 6
Vector
  • 75
  • 43
  • 12
  • 9
  • 4
Insert
  • 71
  • 39
  • 21
  • 8
  • 6
Oligo-Type
  • 4
  • 3
Resistance Gene
  • 78
  • 43
  • 26
  • 2
Expression Type
  • 95
  • 51
  • 44
Selectable Marker
  • 44
  • 26
  • 26
  • 4
Promoter
  • 53
  • 42
  • 31
  • 14
  • 8
Format
  • 92
  • 26
  • 24
  • 12
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Transforming Growth Factor, beta 2 (TGFB2)
Gene ID:
21808 (Mouse (Murine), TGFB2)
Synonyms:
TGFB2, tgfb2.L, Tgfb2, tgfb2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4217726
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Transforming Growth Factor, beta 2 (TGFB2)
Gene ID:
21808 (Mouse (Murine), TGFB2)
Synonyms:
TGFB2, tgfb2.L, Tgfb2, tgfb2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4217730
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Transforming Growth Factor, beta 2 (TGFB2)
Gene ID:
7042 (Human, TGFB2)
Synonyms:
TGFB2, tgfb2.L, Tgfb2, tgfb2
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3986546
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Transforming Growth Factor, beta 2 (TGFB2)
Gene ID:
7042 (Human, TGFB2)
Synonyms:
TGFB2, tgfb2.L, Tgfb2, tgfb2
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3986549
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Transforming Growth Factor, beta 2 (TGFB2)
Species:
Rat (Rattus)
Synonyms:
TGFB2, tgfb2.L, Tgfb2, tgfb2
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3598963
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Transforming Growth Factor, beta 2 (TGFB2)
NCBI Accession:
NM_009367
Species:
Mouse (Murine)
Synonyms:
TGFB2, tgfb2.L, Tgfb2, tgfb2
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3565725
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Application:
Quantitative real-time PCR
Gene:
Transforming Growth Factor, beta 2
Species:
Mouse (Murine)
Synonyms:
LDS4, TGF-beta2, tgf-beta2, tgfb2-A, BB105277, Tgf-beta2, Tgfb-2, TGFB2, TGFbeta2, MGF, TGF-B2
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3193739
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Application:
Quantitative real-time PCR
Gene:
Transforming Growth Factor, beta 2
Species:
Rat (Rattus)
Synonyms:
LDS4, TGF-beta2, tgf-beta2, tgfb2-A, BB105277, Tgf-beta2, Tgfb-2, TGFB2, TGFbeta2, MGF, TGF-B2
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3196279
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Application:
Quantitative real-time PCR
Gene:
Transforming Growth Factor, beta 2
Species:
Human
Synonyms:
LDS4, TGF-beta2, tgf-beta2, tgfb2-A, BB105277, Tgf-beta2, Tgfb-2, TGFB2, TGFbeta2, MGF, TGF-B2
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3188751
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Transforming Growth Factor, beta 2 (TGFB2)
NCBI Accession:
NM_003238
Species:
Human
Synonyms:
TGFB2, tgfb2.L, Tgfb2, tgfb2
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3598964
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Transforming Growth Factor, beta 2 (TGFB2)
NCBI Accession:
XM_001103911
Species:
Rhesus Monkey
Synonyms:
TGFB2, tgfb2.L, Tgfb2, tgfb2
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3565724
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Transforming Growth Factor, beta 2 (TGFB2)
Gene ID:
21808 (Mouse (Murine), TGFB2)
Synonyms:
TGFB2, tgfb2.L, Tgfb2, tgfb2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4217727
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Transforming Growth Factor, beta 2 (TGFB2)
Gene ID:
21808 (Mouse (Murine), TGFB2)
Synonyms:
TGFB2, tgfb2.L, Tgfb2, tgfb2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3811020
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Transforming Growth Factor, beta 2 (TGFB2)
Gene ID:
7042 (Human, TGFB2)
Synonyms:
TGFB2, tgfb2.L, Tgfb2, tgfb2
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3986547
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
cDNA
Application:
Cloning
Gene:
Transforming Growth Factor, beta 2 (TGFB2)
Gene ID:
7042 (Human, TGFB2)
Synonyms:
TGFB2, tgfb2.L, Tgfb2, tgfb2
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3986548
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Transforming Growth Factor, beta 2 (TGFB2)
NCBI Accession:
NM_009367
Species:
Mouse (Murine)
Synonyms:
TGFB2, tgfb2.L, Tgfb2, tgfb2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3598921
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Transforming Growth Factor, beta 2 (TGFB2)
NCBI Accession:
NM_009367
Species:
Mouse (Murine)
Synonyms:
TGFB2, tgfb2.L, Tgfb2, tgfb2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948163

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3598929
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Transforming Growth Factor, beta 2 (TGFB2)
NCBI Accession:
NM_009367
Species:
Mouse (Murine)
Synonyms:
TGFB2, tgfb2.L, Tgfb2, tgfb2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-untagged
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948161

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3598961
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Transforming Growth Factor, beta 2 (TGFB2)
Species:
Rat (Rattus)
Synonyms:
TGFB2, tgfb2.L, Tgfb2, tgfb2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948163

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3598930
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
Supplier: Log in to see

Type:
ORF
Application:
Protein Expression
Gene:
Transforming Growth Factor, beta 2 (TGFB2)
Species:
Rat (Rattus)
Synonyms:
TGFB2, tgfb2.L, Tgfb2, tgfb2
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948173

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3598954
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to TGFB2

  • transforming growth factor beta 2 (TGFB2)
  • transforming growth factor beta 2 L homeolog (tgfb2.L)
  • transforming growth factor, beta 2 (Tgfb2)
  • transforming growth factor, beta 2 (tgfb2)
  • transforming growth factor beta 2 (Tgfb2)
  • BB105277
  • LDS4
  • MGF
  • TGF-B2
  • TGF-beta2
  • tgf-beta2
  • Tgf-beta2
  • Tgfb-2
  • TGFB2
  • tgfb2-A
  • TGFbeta2

Gene-IDs for different species

GENE IDSPECIES
7042 Homo sapiens
373801 Xenopus laevis
397084 Sus scrofa
21808 Mus musculus
369194 Danio rerio
457742 Pan troglodytes
488596 Canis lupus familiaris
534069 Bos taurus
554322 Ovis aries
707540 Macaca mulatta
100009371 Oryctolagus cuniculus
100390586 Callithrix jacchus
100461291 Pongo abelii
100596183 Nomascus leucogenys
81809 Rattus norvegicus
100720726 Cavia porcellus
421352 Gallus gallus
100861228 Capra hircus

Protein level used designations for TGFB2

  • BSC-1 cell growth inhibitor
  • G-TSF
  • cetermin
  • glioblastoma-derived T-cell suppressor factor
  • polyergin
  • transforming growth factor beta-2
  • TGF-beta 2
  • TGF-beta-2
  • prepro-polypeptide
  • Transforming growth factor beta-2
  • transforming growth factor beta 2
  • tgf beta 2
  • transforming growth factor, beta 2
  • milk growth factor
  • transforming growth factor-beta 2
  • transforming growth factor beta-2-like
  • TGF beta 2 protein
  • transforming growth factor-beta2
  • TGF beta 2
Other products related to TGFB2 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com