Thrombospondin 1 (Thrombospondin 1, THBS1)

Short Description: The protein encoded by this gene is a subunit of a disulfide-linked homotrimeric protein. This protein is an adhesive glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. This protein can bind to fibrinogen, fibronectin, laminin, type V collagen and integrins alpha-V/beta-1. This protein has been shown to play roles in platelet aggregation, angiogenesis, and tumorigenesis. [provided by RefSeq, Jul 2008].
More information related to gene Thrombospondin 1.
Products related to Thrombospondin 1 Gene:
123 Products
Data Quality
  • 3
Type
  • 120
  • 3
Species
  • 44
  • 41
  • 24
  • 12
  • 2
Application
  • 77
  • 24
  • 18
  • 16
  • 2
Fusion tag
  • 35
  • 15
  • 14
  • 10
  • 9
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 4
Vector
  • 56
  • 33
  • 12
  • 9
  • 7
Insert
  • 52
  • 35
  • 17
  • 8
  • 6
Oligo-Type
  • 2
  • 1
Resistance Gene
  • 61
  • 36
  • 20
  • 3
  • 2
Expression Type
  • 80
  • 45
  • 33
Selectable Marker
  • 33
  • 24
  • 22
Promoter
  • 39
  • 29
  • 29
  • 13
  • 8
Format
  • 66
  • 27
  • 21
  • 9

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Thrombospondin 1 (THBS1)
Gene ID:
21825 (Mouse (Murine), THBS1)
Synonyms:
THBS1, Thbs1, thbs1.S, thbs1b, thbs1, thbs2.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3811035
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Thrombospondin 1 (THBS1)
Gene ID:
379508 (Xenopus laevis, THBS1)
Synonyms:
THBS1, Thbs1, thbs1.S, thbs1b, thbs1, thbs2.L
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4041062
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Thrombospondin 1 (THBS1)
NCBI Accession:
NM_003246
Species:
Human
Synonyms:
THBS1, Thbs1, thbs1.S, thbs1b, thbs1, thbs2.L
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3565748
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Thrombospondin 1 (THBS1)
NCBI Accession:
XM_005559147
Species:
Cynomolgus
Synonyms:
THBS1, Thbs1, thbs1.S, thbs1b, thbs1, thbs2.L
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3599474
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Thrombospondin 1 (THBS1)
NCBI Accession:
NM_011580
Species:
Mouse (Murine)
Synonyms:
THBS1, Thbs1, thbs1.S, thbs1b, thbs1, thbs2.L
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3599475
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Thrombospondin 1
Species:
Human
Synonyms:
THBS, THBS-1, TSP, TSP-1, TSP1, Thbs-1, tbsp1, thrombospondin-1, thbs, thbs-1, tsp, tsp-1, tsp1, Tsp1, THBS1, Tsp-1, wu:fc48c03, si:dkey-11e23.1, tsp2
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3188864
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Thrombospondin 1
Species:
Mouse (Murine)
Synonyms:
THBS, THBS-1, TSP, TSP-1, TSP1, Thbs-1, tbsp1, thrombospondin-1, thbs, thbs-1, tsp, tsp-1, tsp1, Tsp1, THBS1, Tsp-1, wu:fc48c03, si:dkey-11e23.1, tsp2
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3194190
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Thrombospondin 1 (THBS1)
Gene ID:
21825 (Mouse (Murine), THBS1)
Synonyms:
THBS1, Thbs1, thbs1.S, thbs1b, thbs1, thbs2.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3811033
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Thrombospondin 1 (THBS1)
Gene ID:
379508 (Xenopus laevis, THBS1)
Synonyms:
THBS1, Thbs1, thbs1.S, thbs1b, thbs1, thbs2.L
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4041063
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Application:
RNA Interference
Gene:
Thrombospondin 1
Species:
Rat (Rattus)
Synonyms:
THBS, THBS-1, TSP, TSP-1, TSP1, Thbs-1, tbsp1, thrombospondin-1, thbs, thbs-1, tsp, tsp-1, tsp1, Tsp1, THBS1, Tsp-1, wu:fc48c03, si:dkey-11e23.1, tsp2
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Thbs1 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3351806
$420.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Thrombospondin 1 (THBS1)
NCBI Accession:
NM_003246
Species:
Human
Synonyms:
THBS1, Thbs1, thbs1.S, thbs1b, thbs1, thbs2.L
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of THBS1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5099637
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Thrombospondin 1 (THBS1)
NCBI Accession:
NM_011580
Species:
Mouse (Murine)
Synonyms:
THBS1, Thbs1, thbs1.S, thbs1b, thbs1, thbs2.L
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Thbs1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5099639
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Thrombospondin 1 (THBS1)
NCBI Accession:
NM_001013062
Species:
Rat (Rattus)
Synonyms:
THBS1, Thbs1, thbs1.S, thbs1b, thbs1, thbs2.L
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Thbs1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5099641
$420.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
ORF
Application:
Protein Expression
Gene:
Thrombospondin 1 (THBS1)
NCBI Accession:
NM_003246,NP_003237
Species:
Human
Synonyms:
THBS1, Thbs1, thbs1.S, thbs1b, thbs1, thbs2.L
Insert length:
3513 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5368066
$420.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Thrombospondin 1 (THBS1)
Gene ID:
7057 (Human, THBS1)
Synonyms:
THBS1, Thbs1, thbs1.S, thbs1b, thbs1, thbs2.L
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter, U6 Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Viral particles:
ABIN5061524

Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5042579
$503.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Thrombospondin 1 (THBS1)
NCBI Accession:
NM_003246
Species:
Human
Synonyms:
THBS1, Thbs1, thbs1.S, thbs1b, thbs1, thbs2.L
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of THBS1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5214882
$520.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Thrombospondin 1 (THBS1)
NCBI Accession:
NM_011580
Species:
Mouse (Murine)
Synonyms:
THBS1, Thbs1, thbs1.S, thbs1b, thbs1, thbs2.L
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Thbs1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5214884
$520.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Thrombospondin 1 (THBS1)
NCBI Accession:
NM_001013062
Species:
Rat (Rattus)
Synonyms:
THBS1, Thbs1, thbs1.S, thbs1b, thbs1, thbs2.L
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Thbs1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5214886
$520.00
300 μL
Plus shipping costs $45.00 and $22.60 dry ice
Available

Type:
shRNA
Application:
RNA Interference
Gene:
Thrombospondin 1 (THBS1)
Gene ID:
7057 (Human, THBS1)
Synonyms:
THBS1, Thbs1, thbs1.S, thbs1b, thbs1, thbs2.L
Vector type:
Lentiviral Vector
Vector backbone:
pZIP-mCMV-ZsGreen
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
mCMV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Empty vector controls:
ABIN5691888
Viral particles:
ABIN3467072

Components:
3 separate shRNA clones and a non-targeting control
Format:
Glycerol Stock
Buffer:
E. coli bacterial culture in LB-Lennox (low salt) broth with 8 % glycerol.
Storage:
-80 °C
Catalog No. ABIN3467071
$703.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
shRNA
Application:
RNA Interference
Gene:
Thrombospondin 1 (THBS1)
Gene ID:
21825 (Mouse (Murine), THBS1)
Synonyms:
THBS1, Thbs1, thbs1.S, thbs1b, thbs1, thbs2.L
Vector type:
Lentiviral Vector
Vector backbone:
pZIP-mCMV-ZsGreen
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
mCMV Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Empty vector controls:
ABIN5691888
Viral particles:
ABIN3467072

Components:
3 separate shRNA clones and a non-targeting control
Format:
Glycerol Stock
Buffer:
E. coli bacterial culture in LB-Lennox (low salt) broth with 8 % glycerol.
Storage:
-80 °C
Catalog No. ABIN3788770
$703.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days
  • <
  • 1

Synonyms and alternative names related to Thrombospondin 1

  • thrombospondin 1 (THBS1)
  • thrombospondin 1 (Thbs1)
  • thrombospondin 1 S homeolog (thbs1.S)
  • thrombospondin 1b (thbs1b)
  • thrombospondin 1 (thbs1)
  • thrombospondin 2 L homeolog (thbs2.L)
  • si:dkey-11e23.1
  • tbsp1
  • THBS
  • thbs
  • THBS-1
  • thbs-1
  • Thbs-1
  • THBS1
  • thrombospondin-1
  • tsp
  • TSP
  • TSP-1
  • tsp-1
  • Tsp-1
  • TSP1
  • tsp1
  • Tsp1
  • tsp2
  • wu:fc48c03

Gene-IDs for different species

GENE IDSPECIES
7057 Homo sapiens
21825 Mus musculus
281530 Bos taurus
373987 Gallus gallus
379508 Xenopus laevis
445442 Rattus norvegicus
453319 Pan troglodytes
487486 Canis lupus familiaris
492313 Sus scrofa
561901 Danio rerio
705413 Macaca mulatta
100170153 Xenopus (Silurana) tropicalis
100230636 Taeniopygia guttata
100350430 Oryctolagus cuniculus
100390178 Callithrix jacchus
100453386 Pongo abelii
100465724 Ailuropoda melanoleuca
779026 Xenopus laevis
100057478 Equus caballus
100542373 Meleagris gallopavo
100603886 Nomascus leucogenys
101106433 Ovis aries
100727882 Cavia porcellus

Protein level used designations for Thrombospondin 1

  • thrombospondin-1
  • thrombospondin-1p180
  • thrombospondin 1
  • thrombospondin-1-like
  • thrombospondin 2
Other products related to Thrombospondin 1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com