Thrombospondin 1 (Thrombospondin 1, THBS1)

Short Description: The protein encoded by this gene is a subunit of a disulfide-linked homotrimeric protein. This protein is an adhesive glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. This protein can bind to fibrinogen, fibronectin, laminin, type V collagen and integrins alpha-V/beta-1. This protein has been shown to play roles in platelet aggregation, angiogenesis, and tumorigenesis. [provided by RefSeq, Jul 2008].
More information related to gene Thrombospondin 1.
Products related to Thrombospondin 1 Gene:
123 Products
  • 120
  • 3
  • 44
  • 41
  • 24
  • 12
  • 2
  • 77
  • 24
  • 18
  • 16
  • 2
Fusion tag
  • 35
  • 15
  • 14
  • 10
  • 9
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 4
  • 56
  • 33
  • 12
  • 9
  • 7
  • 52
  • 35
  • 17
  • 8
  • 6
  • 2
  • 1
Resistance Gene
  • 61
  • 36
  • 20
  • 3
  • 2
Expression Type
  • 80
  • 45
  • 33
Selectable Marker
  • 33
  • 24
  • 22
  • 39
  • 29
  • 29
  • 13
  • 8
  • 66
  • 27
  • 21
  • 9

Protein Expression, Cloning
Thrombospondin 1 (THBS1)
Gene ID:
21825 (Mouse (Murine), THBS1)
THBS1, Thbs1, thbs1.S, thbs1b, thbs1, thbs2.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3811035
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Thrombospondin 1 (THBS1)
Gene ID:
379508 (Xenopus laevis, THBS1)
THBS1, Thbs1, thbs1.S, thbs1b, thbs1, thbs2.L
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4041062
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Thrombospondin 1 (THBS1)
NCBI Accession:
THBS1, Thbs1, thbs1.S, thbs1b, thbs1, thbs2.L
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:

Sequencing Primer:
  • M13-47 and RV-M
Catalog No. ABIN3565748
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Thrombospondin 1 (THBS1)
NCBI Accession:
THBS1, Thbs1, thbs1.S, thbs1b, thbs1, thbs2.L
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Catalog No. ABIN3599474
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Thrombospondin 1 (THBS1)
NCBI Accession:
Mouse (Murine)
THBS1, Thbs1, thbs1.S, thbs1b, thbs1, thbs2.L
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:

Sequencing Primer:
  • M13-47 and RV-M
Catalog No. ABIN3599475
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Quantitative real-time PCR
Thrombospondin 1
Mouse (Murine)
THBS, THBS-1, TSP, TSP-1, TSP1, Thbs-1, tbsp1, thrombospondin-1, thbs, thbs-1, tsp, tsp-1, tsp1, Tsp1, THBS1, Tsp-1, wu:fc48c03, si:dkey-11e23.1, tsp2
-20 °C
Catalog No. ABIN3194190
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Quantitative real-time PCR
Thrombospondin 1
THBS, THBS-1, TSP, TSP-1, TSP1, Thbs-1, tbsp1, thrombospondin-1, thbs, thbs-1, tsp, tsp-1, tsp1, Tsp1, THBS1, Tsp-1, wu:fc48c03, si:dkey-11e23.1, tsp2
-20 °C
Catalog No. ABIN3188864
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Protein Expression, Cloning
Thrombospondin 1 (THBS1)
Gene ID:
21825 (Mouse (Murine), THBS1)
THBS1, Thbs1, thbs1.S, thbs1b, thbs1, thbs2.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3811033
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Thrombospondin 1 (THBS1)
Gene ID:
379508 (Xenopus laevis, THBS1)
THBS1, Thbs1, thbs1.S, thbs1b, thbs1, thbs2.L
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4041063
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Genome Editing with Engineered Nucleases, Protein Expression
Thrombospondin 1 (THBS1)
NCBI Accession:
THBS1, Thbs1, thbs1.S, thbs1b, thbs1, thbs2.L
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of THBS1
Viral Particles
-80 °C
Catalog No. ABIN5099637
300 μL
Plus shipping costs $45.00 and $22.00 dry ice

Genome Editing with Engineered Nucleases, Protein Expression
Thrombospondin 1 (THBS1)
NCBI Accession:
Mouse (Murine)
THBS1, Thbs1, thbs1.S, thbs1b, thbs1, thbs2.L
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Thbs1
Viral Particles
-80 °C
Catalog No. ABIN5099639
300 μL
Plus shipping costs $45.00 and $22.00 dry ice

Genome Editing with Engineered Nucleases, Protein Expression
Thrombospondin 1 (THBS1)
NCBI Accession:
Rat (Rattus)
THBS1, Thbs1, thbs1.S, thbs1b, thbs1, thbs2.L
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Thbs1
Viral Particles
-80 °C
Catalog No. ABIN5099641
300 μL
Plus shipping costs $45.00 and $22.00 dry ice

RNA Interference
Thrombospondin 1
Rat (Rattus)
THBS, THBS-1, TSP, TSP-1, TSP1, Thbs-1, tbsp1, thrombospondin-1, thbs, thbs-1, tsp, tsp-1, tsp1, Tsp1, THBS1, Tsp-1, wu:fc48c03, si:dkey-11e23.1, tsp2
HPLC purified
Available with shipment
  • Thbs1 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3351806
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Genome Editing with Engineered Nucleases
Thrombospondin 1 (THBS1)
Gene ID:
7057 (Human, THBS1)
THBS1, Thbs1, thbs1.S, thbs1b, thbs1, thbs2.L
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
SFFV Promoter, U6 Promoter
Fusion Tag:
Transient, Stable

Viral particles:

- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Glycerol Stock
-80 °C
Catalog No. ABIN5042579
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Thrombospondin 1 (THBS1)
NCBI Accession:
THBS1, Thbs1, thbs1.S, thbs1b, thbs1, thbs2.L
Insert length:
3513 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5730290
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

gRNA + Cas9
Genome Editing with Engineered Nucleases, Protein Expression
Thrombospondin 1 (THBS1)
NCBI Accession:
THBS1, Thbs1, thbs1.S, thbs1b, thbs1, thbs2.L
Vector type:
Lentiviral Vector
Resistance Gene:
Selection Marker:
U6 Promoter, SFFV Promoter
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of THBS1
Viral Particles
-80 °C
Catalog No. ABIN5214882
300 μL
Plus shipping costs $45.00 and $22.00 dry ice

gRNA + Cas9
Genome Editing with Engineered Nucleases, Protein Expression
Thrombospondin 1 (THBS1)
NCBI Accession:
Mouse (Murine)
THBS1, Thbs1, thbs1.S, thbs1b, thbs1, thbs2.L
Vector type:
Lentiviral Vector
Resistance Gene:
Selection Marker:
U6 Promoter, SFFV Promoter
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Thbs1
Viral Particles
-80 °C
Catalog No. ABIN5214884
300 μL
Plus shipping costs $45.00 and $22.00 dry ice

gRNA + Cas9
Genome Editing with Engineered Nucleases, Protein Expression
Thrombospondin 1 (THBS1)
NCBI Accession:
Rat (Rattus)
THBS1, Thbs1, thbs1.S, thbs1b, thbs1, thbs2.L
Vector type:
Lentiviral Vector
Resistance Gene:
Selection Marker:
U6 Promoter, SFFV Promoter
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Thbs1
Viral Particles
-80 °C
Catalog No. ABIN5214886
300 μL
Plus shipping costs $45.00 and $22.00 dry ice

Protein Expression
Thrombospondin 1 (THBS1)
NCBI Accession:
THBS1, Thbs1, thbs1.S, thbs1b, thbs1, thbs2.L
Insert length:
3513 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5368066
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Thrombospondin 1 (THBS1)
NCBI Accession:
Mouse (Murine)
THBS1, Thbs1, thbs1.S, thbs1b, thbs1, thbs2.L
Insert length:
3516 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5730291
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days
  • <
  • 1

Synonyms and alternative names related to Thrombospondin 1

  • thrombospondin 1 (THBS1)
  • thrombospondin 1 (Thbs1)
  • thrombospondin 1 S homeolog (thbs1.S)
  • thrombospondin 1b (thbs1b)
  • thrombospondin 1 (thbs1)
  • thrombospondin 2 L homeolog (thbs2.L)
  • si:dkey-11e23.1
  • tbsp1
  • THBS
  • thbs
  • THBS-1
  • thbs-1
  • Thbs-1
  • THBS1
  • thrombospondin-1
  • tsp
  • TSP
  • TSP-1
  • tsp-1
  • Tsp-1
  • TSP1
  • tsp1
  • Tsp1
  • tsp2
  • wu:fc48c03

Gene-IDs for different species

7057 Homo sapiens
21825 Mus musculus
281530 Bos taurus
373987 Gallus gallus
379508 Xenopus laevis
445442 Rattus norvegicus
453319 Pan troglodytes
487486 Canis lupus familiaris
492313 Sus scrofa
561901 Danio rerio
705413 Macaca mulatta
100170153 Xenopus (Silurana) tropicalis
100230636 Taeniopygia guttata
100350430 Oryctolagus cuniculus
100390178 Callithrix jacchus
100453386 Pongo abelii
100465724 Ailuropoda melanoleuca
779026 Xenopus laevis
100057478 Equus caballus
100542373 Meleagris gallopavo
100603886 Nomascus leucogenys
101106433 Ovis aries
100727882 Cavia porcellus

Protein level used designations for Thrombospondin 1

  • thrombospondin-1
  • thrombospondin-1p180
  • thrombospondin 1
  • thrombospondin-1-like
  • thrombospondin 2
Other products related to Thrombospondin 1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website