TIMP1 (TIMP Metallopeptidase Inhibitor 1, TIMP1)

Short Description: This gene belongs to the TIMP gene family. The proteins encoded by this gene family are natural inhibitors of the matrix metalloproteinases (MMPs), a group of peptidases involved in degradation of the extracellular matrix. In addition to its inhibitory role against most of the known MMPs, the encoded protein is able to promote cell proliferation in a wide range of cell types, and may also have an anti-apoptotic function. Transcription of this gene is highly inducible in response to many cytokines and hormones. In addition, the expression from some but not all inactive X chromosomes suggests that this gene inactivation is polymorphic in human females. This gene is located within intron 6 of the synapsin I gene and is transcribed in the opposite direction. [provided by RefSeq, Jul 2008].
More information related to gene TIMP1.
Products related to TIMP1 Gene:
166 Products
Data Quality
  • 2
Type
  • 159
  • 7
Species
  • 62
  • 52
  • 44
  • 6
  • 2
Application
  • 100
  • 44
  • 25
  • 18
  • 3
Fusion tag
  • 57
  • 21
  • 16
  • 11
  • 10
Vector Backbone
  • 8
  • 6
  • 6
  • 6
  • 6
Vector
  • 74
  • 38
  • 20
  • 11
  • 9
Insert
  • 61
  • 59
  • 21
  • 10
  • 6
Oligo-Type
  • 4
  • 3
Resistance Gene
  • 83
  • 51
  • 18
  • 7
  • 2
Expression Type
  • 115
  • 60
  • 33
  • 2
Selectable Marker
  • 38
  • 33
  • 28
  • 1
Promoter
  • 48
  • 39
  • 33
  • 21
  • 10
Format
  • 76
  • 45
  • 24
  • 21

Type:
ORF
Application:
Protein Expression
Gene:
TIMP Metallopeptidase Inhibitor 1 (TIMP1)
NCBI Accession:
NM_003254,NP_003245
Species:
Human
Synonyms:
TIMP1, Timp1
Insert length:
624 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5356491
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
TIMP Metallopeptidase Inhibitor 1 (TIMP1)
Gene ID:
282092 (Cow (Bovine), TIMP1)
Synonyms:
TIMP1, Timp1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3839404
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
TIMP Metallopeptidase Inhibitor 1 (TIMP1)
Gene ID:
116510 (Rat (Rattus), TIMP1)
Synonyms:
TIMP1, Timp1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3879726
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
TIMP Metallopeptidase Inhibitor 1 (TIMP1)
Gene ID:
7076 (Human, TIMP1)
Synonyms:
TIMP1, Timp1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3465215
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
TIMP Metallopeptidase Inhibitor 1 (TIMP1)
Gene ID:
21857 (Mouse (Murine), TIMP1)
Synonyms:
TIMP1, Timp1
Vector type:
Cloning Vector
Vector backbone:
pSPORT1
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4096670
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
TIMP Metallopeptidase Inhibitor 1 (TIMP1)
Gene ID:
100135142 (Xenopus tropicalis, TIMP1)
Synonyms:
TIMP1, Timp1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4026191
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
TIMP Metallopeptidase Inhibitor 1 (TIMP1)
Gene ID:
100135142 (Xenopus tropicalis, TIMP1)
Synonyms:
TIMP1, Timp1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4026192
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
TIMP Metallopeptidase Inhibitor 1 (TIMP1)
NCBI Accession:
NM_053819
Species:
Rat (Rattus)
Synonyms:
TIMP1, Timp1
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3600348
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
TIMP Metallopeptidase Inhibitor 1 (TIMP1)
NCBI Accession:
NM_001044384
Species:
Mouse (Murine)
Synonyms:
TIMP1, Timp1
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3600347
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
TIMP Metallopeptidase Inhibitor 1 (TIMP1)
NCBI Accession:
NM_003254
Species:
Human
Synonyms:
TIMP1, Timp1
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3600346
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
TIMP Metallopeptidase Inhibitor 1
Species:
Human
Synonyms:
TIMP-1, TIMP1, DKFZp468A0912, CLGI, EPA, EPO, HCI, TIMP, Timp, Clgi
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3189148
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
TIMP Metallopeptidase Inhibitor 1
Species:
Mouse (Murine)
Synonyms:
TIMP-1, TIMP1, DKFZp468A0912, CLGI, EPA, EPO, HCI, TIMP, Timp, Clgi
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3193628
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
TIMP Metallopeptidase Inhibitor 1
Species:
Rat (Rattus)
Synonyms:
TIMP-1, TIMP1, DKFZp468A0912, CLGI, EPA, EPO, HCI, TIMP, Timp, Clgi
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3196227
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
ORF
Application:
Cloning
Gene:
TIMP Metallopeptidase Inhibitor 1 (TIMP1)
Species:
Human
Synonyms:
TIMP1, Timp1
Insert length:
624 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5726693
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Cloning
Gene:
TIMP Metallopeptidase Inhibitor 1 (TIMP1)
Species:
Human
Synonyms:
TIMP1, Timp1
Insert length:
510 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5726694
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
ORF
Application:
Cloning
Gene:
TIMP Metallopeptidase Inhibitor 1 (TIMP1)
NCBI Accession:
NM_011593
Species:
Mouse (Murine)
Synonyms:
TIMP1, Timp1
Insert length:
618 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5726695
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
TIMP Metallopeptidase Inhibitor 1 (TIMP1)
Gene ID:
282092 (Cow (Bovine), TIMP1)
Synonyms:
TIMP1, Timp1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3839405
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
TIMP Metallopeptidase Inhibitor 1 (TIMP1)
Gene ID:
116510 (Rat (Rattus), TIMP1)
Synonyms:
TIMP1, Timp1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3879727
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
TIMP Metallopeptidase Inhibitor 1 (TIMP1)
Gene ID:
7076 (Human, TIMP1)
Synonyms:
TIMP1, Timp1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3465217
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
TIMP Metallopeptidase Inhibitor 1 (TIMP1)
Gene ID:
21857 (Mouse (Murine), TIMP1)
Synonyms:
TIMP1, Timp1
Vector type:
Cloning Vector
Vector backbone:
pSPORT1
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4096669
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to TIMP1

  • TIMP metallopeptidase inhibitor 1 (TIMP1)
  • TIMP metallopeptidase inhibitor 1 (Timp1)
  • tissue inhibitor of metalloproteinase 1 (Timp1)
  • CLGI
  • Clgi
  • DKFZp468A0912
  • EPA
  • EPO
  • HCI
  • TIMP
  • Timp
  • TIMP-1
  • TIMP1

Gene-IDs for different species

GENE IDSPECIES
574348 Macaca mulatta
100172253 Pongo abelii
7076 Homo sapiens
282092 Bos taurus
116510 Rattus norvegicus
101686851 Mustela putorius furo
443331 Ovis aries
396862 Sus scrofa
403816 Canis lupus familiaris
100009047 Oryctolagus cuniculus
21857 Mus musculus
100034220 Equus caballus

Protein level used designations for TIMP1

  • tissue inhibitor of matrix metalloproteinase-1
  • TIMP metallopeptidase inhibitor 1
  • Metalloproteinase inhibitor 1
  • TIMP-1
  • collagenase inhibitor
  • erythroid potentiating activity
  • erythroid-potentiating activity
  • fibroblast collagenase inhibitor
  • metalloproteinase inhibitor 1
  • tissue inhibitor of metalloproteinases 1
  • EG-1
  • embryogenin-1
  • tissue inhibitor of metalloproteinase 1 (erythroid potentiating activity, collagenase inhibitor)
  • tissue inhibitor of metallopeptidase 1
  • tissue inhibitor of metalloproteinase 1
  • metalloproteinase tissue inhibitor
  • metalloproteinase tissue inhibitor 1
  • EPA
  • TPA-S1
  • TPA-induced protein
  • collagenase inhibitor 16C8 fibroblast
  • tissue inhibitor of metalloproteinase-1
Other products related to TIMP1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com