TLR3 (Toll-Like Receptor 3, TLR3)

Short Description: The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This receptor is most abundantly expressed in placenta and pancreas, and is restricted to the dendritic subpopulation of the leukocytes. It recognizes dsRNA associated with viral infection, and induces the activation of NF-kappaB and the production of type I interferons. It may thus play a role in host defense against viruses. Use of alternative polyadenylation sites to generate different length transcripts has been noted for this gene. [provided by RefSeq, Jul 2008].
More information related to gene TLR3.
Products related to TLR3 Gene:
138 Products
Data Quality
  • 1
  • 3
Type
  • 133
  • 5
Species
  • 57
  • 42
  • 26
  • 12
  • 1
Application
  • 82
  • 30
  • 23
  • 16
  • 2
Fusion tag
  • 45
  • 15
  • 15
  • 10
  • 9
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 58
  • 36
  • 13
  • 12
  • 9
Insert
  • 56
  • 41
  • 20
  • 8
  • 6
Oligo-Type
  • 3
  • 2
Resistance Gene
  • 70
  • 40
  • 18
  • 5
  • 2
Expression Type
  • 86
  • 49
  • 34
Selectable Marker
  • 34
  • 26
  • 24
  • 6
  • 1
Promoter
  • 40
  • 30
  • 30
  • 13
  • 8
Format
  • 72
  • 27
  • 22
  • 17

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Toll-Like Receptor 3 (TLR3)
Gene ID:
403126 (Zebrafish (Danio rerio), TLR3)
Synonyms:
TLR3, Tlr3, tlr3
Vector type:
Mammalian Expression Vector
Vector backbone:
pME18S-FL3
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • Custom (774)
  • Custom (1194)
  • SV40pA-R-genewiz
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4074782
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Toll-Like Receptor 3 (TLR3)
Gene ID:
7098 (Human, TLR3)
Synonyms:
TLR3, Tlr3, tlr3
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3986577
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Toll-Like Receptor 3 (TLR3)
Gene ID:
7098 (Human, TLR3)
Synonyms:
TLR3, Tlr3, tlr3
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3986575
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Toll-Like Receptor 3 (TLR3)
Gene ID:
7098 (Human, TLR3)
Synonyms:
TLR3, Tlr3, tlr3
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3986576
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Toll-Like Receptor 3 (TLR3)
Gene ID:
142980 (Mouse (Murine), TLR3)
Synonyms:
TLR3, Tlr3, tlr3
Vector type:
Cloning Vector
Vector backbone:
pSPORT1
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4097122
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Toll-Like Receptor 3 (TLR3)
Gene ID:
7098 (Human, TLR3)
Synonyms:
TLR3, Tlr3, tlr3
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4211583
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Toll-Like Receptor 3 (TLR3)
NCBI Accession:
NM_001036685
Species:
Rhesus Monkey
Synonyms:
TLR3, Tlr3, tlr3
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3600802
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Toll-Like Receptor 3 (TLR3)
NCBI Accession:
NM_126166
Species:
Mouse (Murine)
Synonyms:
TLR3, Tlr3, tlr3
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3600804
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Toll-Like Receptor 3 (TLR3)
NCBI Accession:
NM_003265
Species:
Human
Synonyms:
TLR3, Tlr3, tlr3
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3600803
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Toll-Like Receptor 3
Species:
Human
Synonyms:
CD283, IIAE2, AI957183, zgc:123006
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3188591
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Toll-Like Receptor 3
Species:
Mouse (Murine)
Synonyms:
CD283, IIAE2, AI957183, zgc:123006
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3193747
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Toll-Like Receptor 3 (TLR3)
Gene ID:
7098 (Human, TLR3)
Synonyms:
TLR3, Tlr3, tlr3
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3986572
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Toll-Like Receptor 3 (TLR3)
Gene ID:
7098 (Human, TLR3)
Synonyms:
TLR3, Tlr3, tlr3
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3986573
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Toll-Like Receptor 3 (TLR3)
Gene ID:
7098 (Human, TLR3)
Synonyms:
TLR3, Tlr3, tlr3
Vector type:
Cloning Vector
Vector backbone:
pCR-BluntII-TOPO
Resistance Gene:
Kanamycin
Selection Marker:
Bleomycin

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3986574
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Toll-Like Receptor 3 (TLR3)
Gene ID:
142980 (Mouse (Murine), TLR3)
Synonyms:
TLR3, Tlr3, tlr3
Vector type:
Cloning Vector
Vector backbone:
pSPORT1
Resistance Gene:
Ampicillin
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4097123
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Toll-Like Receptor 3 (TLR3)
Gene ID:
7098 (Human, TLR3)
Synonyms:
TLR3, Tlr3, tlr3
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4211582
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Toll-Like Receptor 3 (TLR3)
Gene ID:
7098 (Human, TLR3)
Synonyms:
TLR3, Tlr3, tlr3
Insert length:
2715 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5325695
$214.67
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Toll-Like Receptor 3 (TLR3)
Gene ID:
7098 (Human, TLR3)
Synonyms:
TLR3, Tlr3, tlr3
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3413733
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Toll-Like Receptor 3 (TLR3)
NCBI Accession:
NM_126166
Species:
Mouse (Murine)
Synonyms:
TLR3, Tlr3, tlr3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948172

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3600798
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Toll-Like Receptor 3 (TLR3)
NCBI Accession:
NM_003265
Species:
Human
Synonyms:
TLR3, Tlr3, tlr3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3600769
$397.06
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days
  • <
  • 1

Synonyms and alternative names related to TLR3

  • toll like receptor 3 (TLR3)
  • toll-like receptor 3 (Tlr3)
  • toll like receptor 3 (Tlr3)
  • toll-like receptor 3 (tlr3)
  • AI957183
  • CD283
  • IIAE2
  • zgc:123006

Gene-IDs for different species

GENE IDSPECIES
471374 Pan troglodytes
100409573 Callithrix jacchus
7098 Homo sapiens
142980 Mus musculus
364594 Rattus norvegicus
482905 Canis lupus familiaris
100037937 Sus scrofa
281535 Bos taurus
422720 Gallus gallus
100135634 Cavia porcellus
100009024 Oryctolagus cuniculus
554258 Ovis aries
403126 Danio rerio

Protein level used designations for TLR3

  • toll-like receptor 3
  • toll-like receptor 3-like
  • toll-like receptor 3 variant 1
Other products related to TLR3 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com