TNFRSF11A (Tumor Necrosis Factor Receptor Superfamily, Member 11a, NFKB Activator, TNFRSF11A)

Short Description: The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptors can interact with various TRAF family proteins, through which this receptor induces the activation of NF-kappa B and MAPK8/JNK. This receptor and its ligand are important regulators of the interaction between T cells and dendritic cells. This receptor is also an essential mediator for osteoclast and lymph node development. Mutations at this locus have been associated with familial expansile osteolysis, autosomal recessive osteopetrosis, and Paget disease of bone. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Aug 2012].
More information related to gene TNFRSF11A.
Products related to TNFRSF11A Gene:
Type
  • 102
  • 4
Species
  • 48
  • 41
  • 15
  • 2
Application
  • 78
  • 16
  • 14
  • 13
  • 2
Fusion tag
  • 34
  • 12
  • 12
  • 9
  • 8
Vector Backbone
  • 8
  • 6
  • 6
  • 4
  • 4
Vector
  • 59
  • 28
  • 6
  • 4
  • 3
Insert
  • 55
  • 19
  • 12
  • 8
  • 6
Oligo-Type
  • 2
  • 2
Resistance Gene
  • 48
  • 40
  • 12
  • 2
  • 2
Expression Type
  • 65
  • 37
  • 33
Selectable Marker
  • 33
  • 20
  • 19
Promoter
  • 43
  • 24
  • 24
  • 8
  • 6
Format
  • 69
  • 19
  • 9
  • 9
106 Products

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Tumor Necrosis Factor Receptor Superfamily, Member 11a, NFKB Activator (TNFRSF11A)
Gene ID:
100101765 (Xenopus tropicalis, TNFRSF11A)
Synonyms:
Tnfrsf11a, TNFRSF11A
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3872372
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Tumor Necrosis Factor Receptor Superfamily, Member 11a, NFKB Activator (TNFRSF11A)
Gene ID:
21934 (Mouse (Murine), TNFRSF11A)
Synonyms:
Tnfrsf11a, TNFRSF11A
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3811066
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Tumor Necrosis Factor Receptor Superfamily, Member 11a, NFKB Activator (TNFRSF11A)
NCBI Accession:
NM_001271235
Species:
Rat (Rattus)
Synonyms:
Tnfrsf11a, TNFRSF11A
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3603958
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Tumor Necrosis Factor Receptor Superfamily, Member 11a, NFKB Activator (TNFRSF11A)
NCBI Accession:
NM_009399
Species:
Mouse (Murine)
Synonyms:
Tnfrsf11a, TNFRSF11A
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3603959
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Tumor Necrosis Factor Receptor Superfamily, Member 11a, NFKB Activator (TNFRSF11A)
NCBI Accession:
NM_003839
Species:
Human
Synonyms:
Tnfrsf11a, TNFRSF11A
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3566052
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Tumor Necrosis Factor Receptor Superfamily, Member 11a, NFKB Activator
Species:
Rat (Rattus)
Synonyms:
RANK, RGD1563614, TNFRSF11A, Ly109, ODFR, OFE, Rank, TRANCE-R, mRANK, CD265, FEO, LOH18CR1, OPTB7, OSTS, PDB2, TRANCER
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3196320
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Tumor Necrosis Factor Receptor Superfamily, Member 11a, NFKB Activator
Species:
Mouse (Murine)
Synonyms:
RANK, RGD1563614, TNFRSF11A, Ly109, ODFR, OFE, Rank, TRANCE-R, mRANK, CD265, FEO, LOH18CR1, OPTB7, OSTS, PDB2, TRANCER
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3194040
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Tumor Necrosis Factor Receptor Superfamily, Member 11a, NFKB Activator (TNFRSF11A)
Gene ID:
100101765 (Xenopus tropicalis, TNFRSF11A)
Synonyms:
Tnfrsf11a, TNFRSF11A
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3872371
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Tumor Necrosis Factor Receptor Superfamily, Member 11a, NFKB Activator (TNFRSF11A)
Gene ID:
21934 (Mouse (Murine), TNFRSF11A)
Synonyms:
Tnfrsf11a, TNFRSF11A
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3811065
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
Tumor Necrosis Factor Receptor Superfamily, Member 11a, NFKB Activator (TNFRSF11A)
NCBI Accession:
NM_001270949
Gene ID:
8792 (Human, TNFRSF11A)
Synonyms:
Tnfrsf11a, TNFRSF11A
Insert length:
792 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4922131
$199.00
10 μg
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Tumor Necrosis Factor Receptor Superfamily, Member 11a, NFKB Activator (TNFRSF11A)
Gene ID:
21934 (Mouse (Murine), TNFRSF11A)
Synonyms:
Tnfrsf11a, TNFRSF11A
Vector type:
Mammalian Expression Vector
Vector backbone:
pTCN
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • 3-1291
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4098130
$258.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Tumor Necrosis Factor Receptor Superfamily, Member 11a, NFKB Activator (TNFRSF11A)
NCBI Accession:
NM_003839
Species:
Human
Synonyms:
Tnfrsf11a, TNFRSF11A
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3603925
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Tumor Necrosis Factor Receptor Superfamily, Member 11a, NFKB Activator (TNFRSF11A)
NCBI Accession:
NM_009399
Species:
Mouse (Murine)
Synonyms:
Tnfrsf11a, TNFRSF11A
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3603926
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Tumor Necrosis Factor Receptor Superfamily, Member 11a, NFKB Activator (TNFRSF11A)
NCBI Accession:
NM_001271235
Species:
Rat (Rattus)
Synonyms:
Tnfrsf11a, TNFRSF11A
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3603927
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Tumor Necrosis Factor Receptor Superfamily, Member 11a, NFKB Activator (TNFRSF11A)
NCBI Accession:
NM_009399
Species:
Mouse (Murine)
Synonyms:
Tnfrsf11a, TNFRSF11A
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948163

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3603932
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Tumor Necrosis Factor Receptor Superfamily, Member 11a, NFKB Activator (TNFRSF11A)
NCBI Accession:
NM_003839
Species:
Human
Synonyms:
Tnfrsf11a, TNFRSF11A
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948163

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3603931
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Tumor Necrosis Factor Receptor Superfamily, Member 11a, NFKB Activator (TNFRSF11A)
NCBI Accession:
NM_001271235
Species:
Rat (Rattus)
Synonyms:
Tnfrsf11a, TNFRSF11A
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948163

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3603933
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Tumor Necrosis Factor Receptor Superfamily, Member 11a, NFKB Activator (TNFRSF11A)
NCBI Accession:
NM_009399
Species:
Mouse (Murine)
Synonyms:
Tnfrsf11a, TNFRSF11A
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948165

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3603935
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Tumor Necrosis Factor Receptor Superfamily, Member 11a, NFKB Activator (TNFRSF11A)
NCBI Accession:
NM_003839
Species:
Human
Synonyms:
Tnfrsf11a, TNFRSF11A
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948165

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3603934
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Tumor Necrosis Factor Receptor Superfamily, Member 11a, NFKB Activator (TNFRSF11A)
NCBI Accession:
NM_001271235
Species:
Rat (Rattus)
Synonyms:
Tnfrsf11a, TNFRSF11A
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948165

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3603936
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to TNFRSF11A

  • TNF receptor superfamily member 11A (Tnfrsf11a)
  • TNF receptor superfamily member 11a (TNFRSF11A)
  • tumor necrosis factor receptor superfamily, member 11a, NFKB activator (Tnfrsf11a)
  • CD265
  • FEO
  • LOH18CR1
  • Ly109
  • mRANK
  • ODFR
  • OFE
  • OPTB7
  • OSTS
  • PDB2
  • RANK
  • Rank
  • RGD1563614
  • TNFRSF11A
  • TRANCE-R
  • TRANCER

Gene-IDs for different species

GENE IDSPECIES
498206 Rattus norvegicus
468560 Pan troglodytes
483957 Canis lupus familiaris
530884 Bos taurus
769909 Gallus gallus
100358260 Oryctolagus cuniculus
100433235 Pongo abelii
21934 Mus musculus
8792 Homo sapiens

Protein level used designations for TNFRSF11A

  • tumor necrosis factor receptor superfamily member 11A
  • tumor necrosis factor receptor superfamily, member 11a, NFKB activator
  • receptor activator of nuclear factor-kappa B
  • tumor necrosis factor receptor superfamily member 11A-like
  • osteoclast differentiation factor receptor
  • receptor activator of NF-KB
  • receptor activator of NF-kappaB
  • loss of heterozygosity, 18, chromosomal region 1
Other products related to TNFRSF11A such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com