Topoisomerase I (Topoisomerase (DNA) I, TOP1)

Short Description: This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This enzyme catalyzes the transient breaking and rejoining of a single strand of DNA which allows the strands to pass through one another, thus altering the topology of DNA. This gene is localized to chromosome 20 and has pseudogenes which reside on chromosomes 1 and 22. [provided by RefSeq, Jul 2008].
More information related to gene Topoisomerase I.
Products related to Topoisomerase I Gene:
  • 80
  • 3
  • 29
  • 28
  • 26
  • 43
  • 21
  • 16
  • 15
Fusion tag
  • 26
  • 12
  • 9
  • 9
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 5
  • 5
  • 33
  • 21
  • 12
  • 9
  • 3
  • 27
  • 19
  • 18
  • 8
  • 6
  • 3
Resistance Gene
  • 31
  • 28
  • 16
  • 5
  • 2
Expression Type
  • 78
  • 46
Selectable Marker
  • 26
  • 22
  • 28
  • 26
  • 13
  • 8
  • 6
  • 30
  • 27
  • 20
  • 6
83 Products

Topoisomerase (DNA) I (TOP1)
Top1, top1, topA, ZMO1193, MRAD2831_RS63095, Lferr_0016, PC1_2015, Za10_0136, Gbro_0575, Dd586_2108, Kvar_3044, Alvin_2069, Dacet_0849, Mrub_1615, Arnit_2962, Ndas_4953, Trad_2377, Acear_1653, Mahau_0844, Mesop_4109, Thein_1586, Theth_0241, TOP1ALPHA, top-1, TOP1, top1.1.L
Insert length:
2298 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4713067
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Topoisomerase (DNA) I (TOP1)
Top1, top1, topA, ZMO1193, MRAD2831_RS63095, Lferr_0016, PC1_2015, Za10_0136, Gbro_0575, Dd586_2108, Kvar_3044, Alvin_2069, Dacet_0849, Mrub_1615, Arnit_2962, Ndas_4953, Trad_2377, Acear_1653, Mahau_0844, Mesop_4109, Thein_1586, Theth_0241, TOP1ALPHA, top-1, TOP1, top1.1.L
Insert length:
2298 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
Resistance Gene:
T7 Promoter
Fusion Tag:

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4842198
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
Topoisomerase (DNA) I (TOP1)
Top1, top1, topA, ZMO1193, MRAD2831_RS63095, Lferr_0016, PC1_2015, Za10_0136, Gbro_0575, Dd586_2108, Kvar_3044, Alvin_2069, Dacet_0849, Mrub_1615, Arnit_2962, Ndas_4953, Trad_2377, Acear_1653, Mahau_0844, Mesop_4109, Thein_1586, Theth_0241, TOP1ALPHA, top-1, TOP1, top1.1.L
Insert length:
2298 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4514314
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
Topoisomerase (DNA) I (TOP1)
Top1, top1, topA, ZMO1193, MRAD2831_RS63095, Lferr_0016, PC1_2015, Za10_0136, Gbro_0575, Dd586_2108, Kvar_3044, Alvin_2069, Dacet_0849, Mrub_1615, Arnit_2962, Ndas_4953, Trad_2377, Acear_1653, Mahau_0844, Mesop_4109, Thein_1586, Theth_0241, TOP1ALPHA, top-1, TOP1, top1.1.L
Insert length:
2298 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,His tag
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
-20 °C
Catalog No. ABIN4575523
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Protein Expression
Topoisomerase (DNA) I (TOP1)
Gene ID:
21969 (Mouse, TOP1)
Top1, top1, topA, ZMO1193, MRAD2831_RS63095, Lferr_0016, PC1_2015, Za10_0136, Gbro_0575, Dd586_2108, Kvar_3044, Alvin_2069, Dacet_0849, Mrub_1615, Arnit_2962, Ndas_4953, Trad_2377, Acear_1653, Mahau_0844, Mesop_4109, Thein_1586, Theth_0241, TOP1ALPHA, top-1, TOP1, top1.1.L
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3433603
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression
Topoisomerase (DNA) I (TOP1)
Gene ID:
21969 (Mouse, TOP1)
Top1, top1, topA, ZMO1193, MRAD2831_RS63095, Lferr_0016, PC1_2015, Za10_0136, Gbro_0575, Dd586_2108, Kvar_3044, Alvin_2069, Dacet_0849, Mrub_1615, Arnit_2962, Ndas_4953, Trad_2377, Acear_1653, Mahau_0844, Mesop_4109, Thein_1586, Theth_0241, TOP1ALPHA, top-1, TOP1, top1.1.L
Vector type:
Gateway Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3433991
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Genome Editing with Engineered Nucleases, Protein Expression
Topoisomerase (DNA) I (TOP1)
NCBI Accession:
Top1, top1, topA, ZMO1193, MRAD2831_RS63095, Lferr_0016, PC1_2015, Za10_0136, Gbro_0575, Dd586_2108, Kvar_3044, Alvin_2069, Dacet_0849, Mrub_1615, Arnit_2962, Ndas_4953, Trad_2377, Acear_1653, Mahau_0844, Mesop_4109, Thein_1586, Theth_0241, TOP1ALPHA, top-1, TOP1, top1.1.L
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of TOP1
Viral Particles
-80 °C
Catalog No. ABIN5087244
300 μL
Plus shipping costs $45.00 and $24.00 dry ice

Genome Editing with Engineered Nucleases, Protein Expression
Topoisomerase (DNA) I (TOP1)
NCBI Accession:
Top1, top1, topA, ZMO1193, MRAD2831_RS63095, Lferr_0016, PC1_2015, Za10_0136, Gbro_0575, Dd586_2108, Kvar_3044, Alvin_2069, Dacet_0849, Mrub_1615, Arnit_2962, Ndas_4953, Trad_2377, Acear_1653, Mahau_0844, Mesop_4109, Thein_1586, Theth_0241, TOP1ALPHA, top-1, TOP1, top1.1.L
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Top1
Viral Particles
-80 °C
Catalog No. ABIN5087246
300 μL
Plus shipping costs $45.00 and $24.00 dry ice

Genome Editing with Engineered Nucleases, Protein Expression
Topoisomerase (DNA) I (TOP1)
NCBI Accession:
Top1, top1, topA, ZMO1193, MRAD2831_RS63095, Lferr_0016, PC1_2015, Za10_0136, Gbro_0575, Dd586_2108, Kvar_3044, Alvin_2069, Dacet_0849, Mrub_1615, Arnit_2962, Ndas_4953, Trad_2377, Acear_1653, Mahau_0844, Mesop_4109, Thein_1586, Theth_0241, TOP1ALPHA, top-1, TOP1, top1.1.L
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Selection Marker:
U6 Promoter, PGK Promoter
Stable, Transient

Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Top1
Viral Particles
-80 °C
Catalog No. ABIN5087248
300 μL
Plus shipping costs $45.00 and $24.00 dry ice

RNA Interference
Topoisomerase (DNA) I
CG6146, Dmel\\CG6146, TOP1, TopI, Topo I, TopoI, dTopoI, l(1)G0134, l(1)G0201, l(1)G0229, l(1)G0278, l(1)top1, top1, topo I, topoI, DNA topoisomerase 1 beta, DNA topoisomerase I alpha, MGO1, MGOUN 1, MTE17.1, MTE17_1, TOP1BETA, TOPOISOMERASE 1, TOPI, AI467334, D130064I21Rik, Top-1, Ab2-086, topi
HPLC purified
Available with shipment
  • TOP1 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3344668
1 kit
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Protein Expression
Topoisomerase (DNA) I (TOP1)
NCBI Accession:
Top1, top1, topA, ZMO1193, MRAD2831_RS63095, Lferr_0016, PC1_2015, Za10_0136, Gbro_0575, Dd586_2108, Kvar_3044, Alvin_2069, Dacet_0849, Mrub_1615, Arnit_2962, Ndas_4953, Trad_2377, Acear_1653, Mahau_0844, Mesop_4109, Thein_1586, Theth_0241, TOP1ALPHA, top-1, TOP1, top1.1.L
Insert length:
2298 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5345298
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

RNA Interference
Topoisomerase (DNA) I
CG6146, Dmel\\CG6146, TOP1, TopI, Topo I, TopoI, dTopoI, l(1)G0134, l(1)G0201, l(1)G0229, l(1)G0278, l(1)top1, top1, topo I, topoI, DNA topoisomerase 1 beta, DNA topoisomerase I alpha, MGO1, MGOUN 1, MTE17.1, MTE17_1, TOP1BETA, TOPOISOMERASE 1, TOPI, AI467334, D130064I21Rik, Top-1, Ab2-086, topi
HPLC purified
Available with shipment
  • Top1 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3355785
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

RNA Interference
Topoisomerase (DNA) I
CG6146, Dmel\\CG6146, TOP1, TopI, Topo I, TopoI, dTopoI, l(1)G0134, l(1)G0201, l(1)G0229, l(1)G0278, l(1)top1, top1, topo I, topoI, DNA topoisomerase 1 beta, DNA topoisomerase I alpha, MGO1, MGOUN 1, MTE17.1, MTE17_1, TOP1BETA, TOPOISOMERASE 1, TOPI, AI467334, D130064I21Rik, Top-1, Ab2-086, topi
HPLC purified
Available with shipment
  • Top1 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
-20 °C
Catalog No. ABIN3263136
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Protein Expression
Topoisomerase (DNA) I (TOP1)
Top1, top1, topA, ZMO1193, MRAD2831_RS63095, Lferr_0016, PC1_2015, Za10_0136, Gbro_0575, Dd586_2108, Kvar_3044, Alvin_2069, Dacet_0849, Mrub_1615, Arnit_2962, Ndas_4953, Trad_2377, Acear_1653, Mahau_0844, Mesop_4109, Thein_1586, Theth_0241, TOP1ALPHA, top-1, TOP1, top1.1.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Selection Marker:
CMV Promoter
Fusion Tag:
GFP tag
Stable, Transient

The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5345297
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Genome Editing with Engineered Nucleases
Topoisomerase (DNA) I (TOP1)
Gene ID:
7150 (Human, TOP1)
Top1, top1, topA, ZMO1193, MRAD2831_RS63095, Lferr_0016, PC1_2015, Za10_0136, Gbro_0575, Dd586_2108, Kvar_3044, Alvin_2069, Dacet_0849, Mrub_1615, Arnit_2962, Ndas_4953, Trad_2377, Acear_1653, Mahau_0844, Mesop_4109, Thein_1586, Theth_0241, TOP1ALPHA, top-1, TOP1, top1.1.L
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
SFFV Promoter, U6 Promoter
Fusion Tag:
Transient, Stable

Viral particles:

- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Glycerol Stock
-80 °C
Catalog No. ABIN5042660
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Topoisomerase (DNA) I (TOP1)
Top1, top1, topA, ZMO1193, MRAD2831_RS63095, Lferr_0016, PC1_2015, Za10_0136, Gbro_0575, Dd586_2108, Kvar_3044, Alvin_2069, Dacet_0849, Mrub_1615, Arnit_2962, Ndas_4953, Trad_2377, Acear_1653, Mahau_0844, Mesop_4109, Thein_1586, Theth_0241, TOP1ALPHA, top-1, TOP1, top1.1.L
Insert length:
2298 bp
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
-20 °C
Catalog No. ABIN5722969
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

gRNA + Cas9
Genome Editing with Engineered Nucleases, Protein Expression
Topoisomerase (DNA) I (TOP1)
NCBI Accession:
Top1, top1, topA, ZMO1193, MRAD2831_RS63095, Lferr_0016, PC1_2015, Za10_0136, Gbro_0575, Dd586_2108, Kvar_3044, Alvin_2069, Dacet_0849, Mrub_1615, Arnit_2962, Ndas_4953, Trad_2377, Acear_1653, Mahau_0844, Mesop_4109, Thein_1586, Theth_0241, TOP1ALPHA, top-1, TOP1, top1.1.L
Vector type:
Lentiviral Vector
Resistance Gene:
Selection Marker:
U6 Promoter, SFFV Promoter
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of TOP1
Viral Particles
-80 °C
Catalog No. ABIN5202386
300 μL
Plus shipping costs $45.00 and $24.00 dry ice

gRNA + Cas9
Genome Editing with Engineered Nucleases, Protein Expression
Topoisomerase (DNA) I (TOP1)
NCBI Accession:
Top1, top1, topA, ZMO1193, MRAD2831_RS63095, Lferr_0016, PC1_2015, Za10_0136, Gbro_0575, Dd586_2108, Kvar_3044, Alvin_2069, Dacet_0849, Mrub_1615, Arnit_2962, Ndas_4953, Trad_2377, Acear_1653, Mahau_0844, Mesop_4109, Thein_1586, Theth_0241, TOP1ALPHA, top-1, TOP1, top1.1.L
Vector type:
Lentiviral Vector
Resistance Gene:
Selection Marker:
U6 Promoter, SFFV Promoter
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Top1
Viral Particles
-80 °C
Catalog No. ABIN5202388
300 μL
Plus shipping costs $45.00 and $24.00 dry ice

gRNA + Cas9
Genome Editing with Engineered Nucleases, Protein Expression
Topoisomerase (DNA) I (TOP1)
NCBI Accession:
Top1, top1, topA, ZMO1193, MRAD2831_RS63095, Lferr_0016, PC1_2015, Za10_0136, Gbro_0575, Dd586_2108, Kvar_3044, Alvin_2069, Dacet_0849, Mrub_1615, Arnit_2962, Ndas_4953, Trad_2377, Acear_1653, Mahau_0844, Mesop_4109, Thein_1586, Theth_0241, TOP1ALPHA, top-1, TOP1, top1.1.L
Vector type:
Lentiviral Vector
Resistance Gene:
Selection Marker:
U6 Promoter, SFFV Promoter
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Top1
Viral Particles
-80 °C
Catalog No. ABIN5202390
300 μL
Plus shipping costs $45.00 and $24.00 dry ice

Protein Expression
Topoisomerase (DNA) I (TOP1)
NCBI Accession:
Top1, top1, topA, ZMO1193, MRAD2831_RS63095, Lferr_0016, PC1_2015, Za10_0136, Gbro_0575, Dd586_2108, Kvar_3044, Alvin_2069, Dacet_0849, Mrub_1615, Arnit_2962, Ndas_4953, Trad_2377, Acear_1653, Mahau_0844, Mesop_4109, Thein_1586, Theth_0241, TOP1ALPHA, top-1, TOP1, top1.1.L
Insert length:
2298 bp
Vector type:
Lentiviral Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

10 μg of lyophilized plasmid
4 °C/-20 °C
Catalog No. ABIN5345302
10 μg
Plus shipping costs $45.00
Delivery in 2 to 3 Business Days
  • <
  • 1

Synonyms and alternative names related to Topoisomerase I

  • Topoisomerase 1 (Top1)
  • DNA topoisomerase I (top1)
  • DNA topoisomerase I (topA)
  • DNA topoisomerase I (ZMO1193)
  • DNA topoisomerase I (MRAD2831_RS63095)
  • DNA topoisomerase I (Lferr_0016)
  • DNA topoisomerase I (PC1_2015)
  • DNA topoisomerase I (Za10_0136)
  • DNA topoisomerase I (Gbro_0575)
  • DNA topoisomerase I (Dd586_2108)
  • DNA topoisomerase I (Kvar_3044)
  • DNA topoisomerase I (Alvin_2069)
  • DNA topoisomerase I (Dacet_0849)
  • DNA topoisomerase I (Mrub_1615)
  • DNA topoisomerase I (Arnit_2962)
  • DNA topoisomerase I (Ndas_4953)
  • DNA topoisomerase I (Trad_2377)
  • DNA topoisomerase I (Acear_1653)
  • DNA topoisomerase I (Mahau_0844)
  • DNA topoisomerase I (Mesop_4109)
  • DNA topoisomerase I (Thein_1586)
  • DNA topoisomerase I (Theth_0241)
  • DNA topoisomerase I alpha (TOP1ALPHA)
  • DNA topoisomerase 1 (top-1)
  • DNA topoisomerase I (TOP1)
  • topoisomerase (DNA) I (Top1)
  • DNA topoisomerase I (Top1)
  • DNA topoisomerase I, gene 1 L homeolog (top1.1.L)
  • Ab2-086
  • AI467334
  • CG6146
  • D130064I21Rik
  • Dmel\\CG6146
  • DNA topoisomerase 1 beta
  • DNA topoisomerase I alpha
  • dTopoI
  • l(1)G0134
  • l(1)G0201
  • l(1)G0229
  • l(1)G0278
  • l(1)top1
  • MGO1
  • MGOUN 1
  • MTE17.1
  • MTE17_1
  • Top-1
  • top1
  • TOP1
  • TOPI
  • topi
  • TopI
  • topo I
  • TopoI
  • Topo I
  • topoI

Gene-IDs for different species

32458 Drosophila melanogaster
2540032 Schizosaccharomyces pombe 972h-
2649678 Corynebacterium diphtheriae NCTC 13129
3189286 Zymomonas mobilis subsp. mobilis ZM4 = ATCC 31821
6141892 Methylobacterium radiotolerans JCM 2831
6875965 Acidithiobacillus ferrooxidans ATCC 53993
8132959 Pectobacterium carotovorum subsp. carotovorum PC1
8471215 Zymomonas mobilis subsp. mobilis NCIMB 11163
8549909 Gordonia bronchialis DSM 43247
8661047 Dickeya dadantii Ech586
8783203 Klebsiella variicola At-22
8787439 Allochromatium vinosum DSM 180
8875197 Denitrovibrio acetiphilus DSM 12809
8879720 Meiothermus ruber DSM 1279
9173158 Arcobacter nitrofigilis DSM 7299
9248841 Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
9281380 Truepera radiovictrix DSM 17093
9513710 Acetohalobium arabaticum DSM 5501
10607584 Mahella australiensis 50-1 BON
10827957 Mesorhizobium opportunistum WSM2075
10841850 Thermodesulfatator indicus DSM 15286
10884985 Thermotoga thermarum DSM 5069
835623 Arabidopsis thaliana
266847 Caenorhabditis elegans
7150 Homo sapiens
21969 Mus musculus
64550 Rattus norvegicus
399263 Xenopus laevis

Protein level used designations for Topoisomerase I

  • CG6146-PA
  • CG6146-PB
  • CG6146-PC
  • CG6146-PD
  • Top1-PA
  • Top1-PB
  • Top1-PC
  • Top1-PD
  • topoisomerase 1
  • topoisomerase I
  • topoisomerase1
  • type I topoisomerase
  • DNA topoisomerase I
  • DNA topoisomerase 1
  • type I DNA topoisomerase
Other products related to Topoisomerase I such as antibodies, ELISA kits and high-purity proteins are available on our partner website