Topoisomerase I (Topoisomerase (DNA) I, TOP1)

Short Description: This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This enzyme catalyzes the transient breaking and rejoining of a single strand of DNA which allows the strands to pass through one another, thus altering the topology of DNA. This gene is localized to chromosome 20 and has pseudogenes which reside on chromosomes 1 and 22. [provided by RefSeq, Jul 2008].
More information related to gene Topoisomerase I.
Products related to Topoisomerase I Gene:
87 Products
Type
  • 83
  • 4
Species
  • 31
  • 29
  • 27
Application
  • 43
  • 25
  • 16
  • 15
Fusion tag
  • 27
  • 15
  • 9
  • 9
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 5
  • 5
Vector
  • 33
  • 24
  • 12
  • 9
  • 3
Insert
  • 27
  • 21
  • 19
  • 8
  • 6
Oligo-Type
  • 4
Resistance Gene
  • 34
  • 28
  • 16
  • 5
  • 2
Expression Type
  • 81
  • 49
Selectable Marker
  • 26
  • 25
Promoter
  • 31
  • 29
  • 13
  • 8
  • 6
Format
  • 34
  • 27
  • 20
  • 6

Type:
cDNA
Application:
Protein Expression
Gene:
Topoisomerase (DNA) I (TOP1)
Species:
Human
Synonyms:
Top1, top1, topA, ZMO1193, MRAD2831_RS63095, Lferr_0016, PC1_2015, Za10_0136, Gbro_0575, Dd586_2108, Kvar_3044, Alvin_2069, Dacet_0849, Mrub_1615, Arnit_2962, Ndas_4953, Trad_2377, Acear_1653, Mahau_0844, Mesop_4109, Thein_1586, Theth_0241, TOP1ALPHA, top-1, TOP1, top1.1.L
Insert length:
2298 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-N-D-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,HA tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4514314
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Topoisomerase (DNA) I (TOP1)
Species:
Human
Synonyms:
Top1, top1, topA, ZMO1193, MRAD2831_RS63095, Lferr_0016, PC1_2015, Za10_0136, Gbro_0575, Dd586_2108, Kvar_3044, Alvin_2069, Dacet_0849, Mrub_1615, Arnit_2962, Ndas_4953, Trad_2377, Acear_1653, Mahau_0844, Mesop_4109, Thein_1586, Theth_0241, TOP1ALPHA, top-1, TOP1, top1.1.L
Insert length:
2298 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pPM-N-D-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag,His tag
Expression:
Stable, Transient

Sequencing Primer:
  • CMV sequencing primer: 5` CGC AAA TGG GCG GTA GGC GTG 3`
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4575523
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Topoisomerase (DNA) I (TOP1)
Species:
Human
Synonyms:
Top1, top1, topA, ZMO1193, MRAD2831_RS63095, Lferr_0016, PC1_2015, Za10_0136, Gbro_0575, Dd586_2108, Kvar_3044, Alvin_2069, Dacet_0849, Mrub_1615, Arnit_2962, Ndas_4953, Trad_2377, Acear_1653, Mahau_0844, Mesop_4109, Thein_1586, Theth_0241, TOP1ALPHA, top-1, TOP1, top1.1.L
Insert length:
2298 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4713067
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Topoisomerase (DNA) I (TOP1)
Species:
Human
Synonyms:
Top1, top1, topA, ZMO1193, MRAD2831_RS63095, Lferr_0016, PC1_2015, Za10_0136, Gbro_0575, Dd586_2108, Kvar_3044, Alvin_2069, Dacet_0849, Mrub_1615, Arnit_2962, Ndas_4953, Trad_2377, Acear_1653, Mahau_0844, Mesop_4109, Thein_1586, Theth_0241, TOP1ALPHA, top-1, TOP1, top1.1.L
Insert length:
2298 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4842198
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Topoisomerase (DNA) I (TOP1)
Gene ID:
21969 (Mouse (Murine), TOP1)
Synonyms:
Top1, top1, topA, ZMO1193, MRAD2831_RS63095, Lferr_0016, PC1_2015, Za10_0136, Gbro_0575, Dd586_2108, Kvar_3044, Alvin_2069, Dacet_0849, Mrub_1615, Arnit_2962, Ndas_4953, Trad_2377, Acear_1653, Mahau_0844, Mesop_4109, Thein_1586, Theth_0241, TOP1ALPHA, top-1, TOP1, top1.1.L
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR223-1
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3433603
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Topoisomerase (DNA) I (TOP1)
Gene ID:
21969 (Mouse (Murine), TOP1)
Synonyms:
Top1, top1, topA, ZMO1193, MRAD2831_RS63095, Lferr_0016, PC1_2015, Za10_0136, Gbro_0575, Dd586_2108, Kvar_3044, Alvin_2069, Dacet_0849, Mrub_1615, Arnit_2962, Ndas_4953, Trad_2377, Acear_1653, Mahau_0844, Mesop_4109, Thein_1586, Theth_0241, TOP1ALPHA, top-1, TOP1, top1.1.L
Vector type:
Gateway Cloning Vector
Vector backbone:
pENTR223-1
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • T7
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3433991
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Topoisomerase (DNA) I (TOP1)
NCBI Accession:
NM_003286
Species:
Human
Synonyms:
Top1, top1, topA, ZMO1193, MRAD2831_RS63095, Lferr_0016, PC1_2015, Za10_0136, Gbro_0575, Dd586_2108, Kvar_3044, Alvin_2069, Dacet_0849, Mrub_1615, Arnit_2962, Ndas_4953, Trad_2377, Acear_1653, Mahau_0844, Mesop_4109, Thein_1586, Theth_0241, TOP1ALPHA, top-1, TOP1, top1.1.L
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of TOP1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5087244
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Topoisomerase (DNA) I (TOP1)
NCBI Accession:
NM_009408
Species:
Mouse (Murine)
Synonyms:
Top1, top1, topA, ZMO1193, MRAD2831_RS63095, Lferr_0016, PC1_2015, Za10_0136, Gbro_0575, Dd586_2108, Kvar_3044, Alvin_2069, Dacet_0849, Mrub_1615, Arnit_2962, Ndas_4953, Trad_2377, Acear_1653, Mahau_0844, Mesop_4109, Thein_1586, Theth_0241, TOP1ALPHA, top-1, TOP1, top1.1.L
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Top1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5087246
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Topoisomerase (DNA) I (TOP1)
NCBI Accession:
NM_022615
Species:
Rat (Rattus)
Synonyms:
Top1, top1, topA, ZMO1193, MRAD2831_RS63095, Lferr_0016, PC1_2015, Za10_0136, Gbro_0575, Dd586_2108, Kvar_3044, Alvin_2069, Dacet_0849, Mrub_1615, Arnit_2962, Ndas_4953, Trad_2377, Acear_1653, Mahau_0844, Mesop_4109, Thein_1586, Theth_0241, TOP1ALPHA, top-1, TOP1, top1.1.L
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Top1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5087248
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
ORF
Application:
Protein Expression
Gene:
Topoisomerase (DNA) I (TOP1)
NCBI Accession:
NM_003286,NP_003277
Species:
Human
Synonyms:
Top1, top1, topA, ZMO1193, MRAD2831_RS63095, Lferr_0016, PC1_2015, Za10_0136, Gbro_0575, Dd586_2108, Kvar_3044, Alvin_2069, Dacet_0849, Mrub_1615, Arnit_2962, Ndas_4953, Trad_2377, Acear_1653, Mahau_0844, Mesop_4109, Thein_1586, Theth_0241, TOP1ALPHA, top-1, TOP1, top1.1.L
Insert length:
2298 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5345298
$420.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Application:
RNA Interference
Gene:
Topoisomerase (DNA) I
Species:
Rat (Rattus)
Synonyms:
CG6146, Dmel\\CG6146, TOP1, TopI, Topo I, TopoI, dTopoI, l(1)G0134, l(1)G0201, l(1)G0229, l(1)G0278, l(1)top1, top1, topo I, topoI, DNA topoisomerase 1 beta, DNA topoisomerase I alpha, MGO1, MGOUN 1, MTE17.1, MTE17_1, TOP1BETA, TOPOISOMERASE 1, TOPI, AI467334, D130064I21Rik, Top-1, Ab2-086, topi
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Top1 (Rat) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3355785
$430.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Topoisomerase (DNA) I
Species:
Mouse (Murine)
Synonyms:
CG6146, Dmel\\CG6146, TOP1, TopI, Topo I, TopoI, dTopoI, l(1)G0134, l(1)G0201, l(1)G0229, l(1)G0278, l(1)top1, top1, topo I, topoI, DNA topoisomerase 1 beta, DNA topoisomerase I alpha, MGO1, MGOUN 1, MTE17.1, MTE17_1, TOP1BETA, TOPOISOMERASE 1, TOPI, AI467334, D130064I21Rik, Top-1, Ab2-086, topi
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Top1 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3263136
$430.00
1 kit
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Application:
RNA Interference
Gene:
Topoisomerase (DNA) I
Species:
Human
Synonyms:
CG6146, Dmel\\CG6146, TOP1, TopI, Topo I, TopoI, dTopoI, l(1)G0134, l(1)G0201, l(1)G0229, l(1)G0278, l(1)top1, top1, topo I, topoI, DNA topoisomerase 1 beta, DNA topoisomerase I alpha, MGO1, MGOUN 1, MTE17.1, MTE17_1, TOP1BETA, TOPOISOMERASE 1, TOPI, AI467334, D130064I21Rik, Top-1, Ab2-086, topi
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • TOP1 (Human) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3344668
$430.00
1 kit
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Topoisomerase (DNA) I (TOP1)
Species:
Human
Synonyms:
Top1, top1, topA, ZMO1193, MRAD2831_RS63095, Lferr_0016, PC1_2015, Za10_0136, Gbro_0575, Dd586_2108, Kvar_3044, Alvin_2069, Dacet_0849, Mrub_1615, Arnit_2962, Ndas_4953, Trad_2377, Acear_1653, Mahau_0844, Mesop_4109, Thein_1586, Theth_0241, TOP1ALPHA, top-1, TOP1, top1.1.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-AC-GFP
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
GFP tag
Expression:
Stable, Transient

Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5345297
$460.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
gRNA + gRNA
Application:
Genome Editing with Engineered Nucleases
Gene:
Topoisomerase (DNA) I (TOP1)
Gene ID:
7150 (Human, TOP1)
Synonyms:
Top1, top1, topA, ZMO1193, MRAD2831_RS63095, Lferr_0016, PC1_2015, Za10_0136, Gbro_0575, Dd586_2108, Kvar_3044, Alvin_2069, Dacet_0849, Mrub_1615, Arnit_2962, Ndas_4953, Trad_2377, Acear_1653, Mahau_0844, Mesop_4109, Thein_1586, Theth_0241, TOP1ALPHA, top-1, TOP1, top1.1.L
Vector type:
Lentiviral Vector
Vector backbone:
pCLIP-dual-SFFV-ZsGreen
Resistance Gene:
Ampicillin, Zeocin
Selection Marker:
Puromycin
Promoter:
SFFV Promoter, U6 Promoter
Fusion Tag:
ZsGreen
Expression:
Transient, Stable

Viral particles:
ABIN5061605

Components:
- Two vectors containing two gRNAs in each vector
- Negative control
- Available as bacterial glycerol stocks or viral particles
- Cas9 expression vectors can be purchased separately
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN5042660
$503.00
1 set
Plus shipping costs $45.00
Will be delivered in 16 Business Days

Type:
ORF
Application:
Cloning
Gene:
Topoisomerase (DNA) I (TOP1)
Species:
Human
Synonyms:
Top1, top1, topA, ZMO1193, MRAD2831_RS63095, Lferr_0016, PC1_2015, Za10_0136, Gbro_0575, Dd586_2108, Kvar_3044, Alvin_2069, Dacet_0849, Mrub_1615, Arnit_2962, Ndas_4953, Trad_2377, Acear_1653, Mahau_0844, Mesop_4109, Thein_1586, Theth_0241, TOP1ALPHA, top-1, TOP1, top1.1.L
Insert length:
2298 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5722969
$511.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Application:
RNA Interference
Gene:
Topoisomerase (DNA) I
Gene ID:
7150 (Human, TOP1)
Synonyms:
CG6146, Dmel\\CG6146, TOP1, TopI, Topo I, TopoI, dTopoI, l(1)G0134, l(1)G0201, l(1)G0229, l(1)G0278, l(1)top1, top1, topo I, topoI, DNA topoisomerase 1 beta, DNA topoisomerase I alpha, MGO1, MGOUN 1, MTE17.1, MTE17_1, TOP1BETA, TOPOISOMERASE 1, TOPI, AI467334, D130064I21Rik, Top-1, Ab2-086, topi
Purification:
Oligonucleotide synthesis is monitored base by base through trityl analysis to ensure appropriate coupling efficiency. The oligo is subsequently purified by affinity-solid phase extraction. The annealed RNA duplex is further analyzed by mass spectrometry to verify the exact composition of the duplex. Each lot is compared to the previous lot by mass spectrometry to ensure maximum lot-to-lot consistency.
Components:
This product is provided as two 5 nmol vials (10 nmol), three 5 nmol vials (15 nmol) or 2x three 5 nmol vials (30 nmol) of lyophilized siRNA oligo duplexes. Each vial contains slightly different sequences to ensure full knockout of the gene. Each vial contains slightly different sequences to ensure full knockout of the gene. The duplexes can be transfected individually or pooled together to achieve knockdown of the target gene, which is most commonly assessed by qPCR or western blot. The siRNA oligos are also chemically modified (2'-OMe) for increased stability and enhanced knockdown in vitro and in vivo.
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5783293
$511.63
Plus shipping costs $45.00
Delivery in 16 to 26 Business Days

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Topoisomerase (DNA) I (TOP1)
NCBI Accession:
NM_003286
Species:
Human
Synonyms:
Top1, top1, topA, ZMO1193, MRAD2831_RS63095, Lferr_0016, PC1_2015, Za10_0136, Gbro_0575, Dd586_2108, Kvar_3044, Alvin_2069, Dacet_0849, Mrub_1615, Arnit_2962, Ndas_4953, Trad_2377, Acear_1653, Mahau_0844, Mesop_4109, Thein_1586, Theth_0241, TOP1ALPHA, top-1, TOP1, top1.1.L
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of TOP1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5202386
$520.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Topoisomerase (DNA) I (TOP1)
NCBI Accession:
NM_009408
Species:
Mouse (Murine)
Synonyms:
Top1, top1, topA, ZMO1193, MRAD2831_RS63095, Lferr_0016, PC1_2015, Za10_0136, Gbro_0575, Dd586_2108, Kvar_3044, Alvin_2069, Dacet_0849, Mrub_1615, Arnit_2962, Ndas_4953, Trad_2377, Acear_1653, Mahau_0844, Mesop_4109, Thein_1586, Theth_0241, TOP1ALPHA, top-1, TOP1, top1.1.L
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Top1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5202388
$520.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA + Cas9
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Topoisomerase (DNA) I (TOP1)
NCBI Accession:
NM_022615
Species:
Rat (Rattus)
Synonyms:
Top1, top1, topA, ZMO1193, MRAD2831_RS63095, Lferr_0016, PC1_2015, Za10_0136, Gbro_0575, Dd586_2108, Kvar_3044, Alvin_2069, Dacet_0849, Mrub_1615, Arnit_2962, Ndas_4953, Trad_2377, Acear_1653, Mahau_0844, Mesop_4109, Thein_1586, Theth_0241, TOP1ALPHA, top-1, TOP1, top1.1.L
Vector type:
Lentiviral Vector
Resistance Gene:
Ampicillin
Selection Marker:
Puromycin
Promoter:
U6 Promoter, SFFV Promoter
Expression:
Stable, Transient

Sequencing Primer:
  • U6 Forward Primer: 5'--TACGTCCAAGGTCGGGCAGGAAGA--3'
Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Top1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5202390
$520.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available
  • <
  • 1

Synonyms and alternative names related to Topoisomerase I

  • Topoisomerase 1 (Top1)
  • DNA topoisomerase I (top1)
  • DNA topoisomerase I (topA)
  • DNA topoisomerase I (ZMO1193)
  • DNA topoisomerase I (MRAD2831_RS63095)
  • DNA topoisomerase I (Lferr_0016)
  • DNA topoisomerase I (PC1_2015)
  • DNA topoisomerase I (Za10_0136)
  • DNA topoisomerase I (Gbro_0575)
  • DNA topoisomerase I (Dd586_2108)
  • DNA topoisomerase I (Kvar_3044)
  • DNA topoisomerase I (Alvin_2069)
  • DNA topoisomerase I (Dacet_0849)
  • DNA topoisomerase I (Mrub_1615)
  • DNA topoisomerase I (Arnit_2962)
  • DNA topoisomerase I (Ndas_4953)
  • DNA topoisomerase I (Trad_2377)
  • DNA topoisomerase I (Acear_1653)
  • DNA topoisomerase I (Mahau_0844)
  • DNA topoisomerase I (Mesop_4109)
  • DNA topoisomerase I (Thein_1586)
  • DNA topoisomerase I (Theth_0241)
  • DNA topoisomerase I alpha (TOP1ALPHA)
  • DNA topoisomerase 1 (top-1)
  • DNA topoisomerase I (TOP1)
  • topoisomerase (DNA) I (Top1)
  • DNA topoisomerase I (Top1)
  • DNA topoisomerase I, gene 1 L homeolog (top1.1.L)
  • Ab2-086
  • AI467334
  • CG6146
  • D130064I21Rik
  • Dmel\\CG6146
  • DNA topoisomerase 1 beta
  • DNA topoisomerase I alpha
  • dTopoI
  • l(1)G0134
  • l(1)G0201
  • l(1)G0229
  • l(1)G0278
  • l(1)top1
  • MGO1
  • MGOUN 1
  • MTE17.1
  • MTE17_1
  • Top-1
  • top1
  • TOP1
  • TOP1BETA
  • TOPI
  • topi
  • TopI
  • topo I
  • TopoI
  • Topo I
  • topoI
  • TOPOISOMERASE 1

Gene-IDs for different species

GENE IDSPECIES
32458 Drosophila melanogaster
2540032 Schizosaccharomyces pombe 972h-
2649678 Corynebacterium diphtheriae NCTC 13129
3189286 Zymomonas mobilis subsp. mobilis ZM4 = ATCC 31821
6141892 Methylobacterium radiotolerans JCM 2831
6875965 Acidithiobacillus ferrooxidans ATCC 53993
8132959 Pectobacterium carotovorum subsp. carotovorum PC1
8471215 Zymomonas mobilis subsp. mobilis NCIMB 11163
8549909 Gordonia bronchialis DSM 43247
8661047 Dickeya dadantii Ech586
8783203 Klebsiella variicola At-22
8787439 Allochromatium vinosum DSM 180
8875197 Denitrovibrio acetiphilus DSM 12809
8879720 Meiothermus ruber DSM 1279
9173158 Arcobacter nitrofigilis DSM 7299
9248841 Nocardiopsis dassonvillei subsp. dassonvillei DSM 43111
9281380 Truepera radiovictrix DSM 17093
9513710 Acetohalobium arabaticum DSM 5501
10607584 Mahella australiensis 50-1 BON
10827957 Mesorhizobium opportunistum WSM2075
10841850 Thermodesulfatator indicus DSM 15286
10884985 Thermotoga thermarum DSM 5069
835623 Arabidopsis thaliana
266847 Caenorhabditis elegans
7150 Homo sapiens
21969 Mus musculus
64550 Rattus norvegicus
399263 Xenopus laevis

Protein level used designations for Topoisomerase I

  • CG6146-PA
  • CG6146-PB
  • CG6146-PC
  • CG6146-PD
  • Top1-PA
  • Top1-PB
  • Top1-PC
  • Top1-PD
  • topoisomerase 1
  • topoisomerase I
  • topoisomerase1
  • type I topoisomerase
  • DNA topoisomerase I
  • DNA topoisomerase 1
  • type I DNA topoisomerase
Other products related to Topoisomerase I such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com