TRAF3 (TNF Receptor-Associated Factor 3, TRAF3)

Short Description: The protein encoded by this gene is a member of the TNF receptor associated factor (TRAF) protein family. TRAF proteins associate with, and mediate the signal transduction from, members of the TNF receptor (TNFR) superfamily. This protein participates in the signal transduction of CD40, a TNFR family member important for the activation of the immune response. This protein is found to be a critical component of the lymphotoxin-beta receptor (LTbetaR) signaling complex, which induces NF-kappaB activation and cell death initiated by LTbeta ligation. Epstein-Barr virus encoded latent infection membrane protein-1 (LMP1) can interact with this and several other members of the TRAF family, which may be essential for the oncogenic effects of LMP1. Several alternatively spliced transcript variants encoding three distinct isoforms have been reported. [provided by RefSeq, Dec 2010].
More information related to gene TRAF3.
Products related to TRAF3 Gene:
125 Products
Data Quality
  • 1
Type
  • 123
  • 2
Species
  • 52
  • 46
  • 25
  • 2
Application
  • 71
  • 30
  • 22
  • 16
Fusion tag
  • 38
  • 23
  • 18
  • 12
  • 8
Vector Backbone
  • 11
  • 11
  • 10
  • 8
  • 6
Vector
  • 45
  • 41
  • 16
  • 12
  • 9
Insert
  • 49
  • 38
  • 20
  • 8
  • 6
Oligo-Type
  • 2
Resistance Gene
  • 47
  • 44
  • 28
  • 4
  • 2
Expression Type
  • 115
  • 57
Selectable Marker
  • 44
  • 26
Promoter
  • 52
  • 30
  • 18
  • 11
  • 8
Format
  • 49
  • 36
  • 26
  • 14

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
TNF Receptor-Associated Factor 3 (TRAF3)
Gene ID:
445119 (Zebrafish (Danio rerio), TRAF3)
Synonyms:
TRAF3, Traf3
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4058231
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
TNF Receptor-Associated Factor 3 (TRAF3)
Gene ID:
22031 (Mouse (Murine), TRAF3)
Synonyms:
TRAF3, Traf3
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4004056
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
TNF Receptor-Associated Factor 3 (TRAF3)
Gene ID:
22031 (Mouse (Murine), TRAF3)
Synonyms:
TRAF3, Traf3
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4004057
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
TNF Receptor-Associated Factor 3 (TRAF3)
Gene ID:
7187 (Human, TRAF3)
Synonyms:
TRAF3, Traf3
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4000535
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
TNF Receptor-Associated Factor 3 (TRAF3)
Gene ID:
7187 (Human, TRAF3)
Synonyms:
TRAF3, Traf3
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4000536
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
TNF Receptor-Associated Factor 3 (TRAF3)
Gene ID:
445119 (Zebrafish (Danio rerio), TRAF3)
Synonyms:
TRAF3, Traf3
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4058230
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
TNF Receptor-Associated Factor 3 (TRAF3)
Gene ID:
22031 (Mouse (Murine), TRAF3)
Synonyms:
TRAF3, Traf3
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4004058
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
TNF Receptor-Associated Factor 3 (TRAF3)
Gene ID:
22031 (Mouse (Murine), TRAF3)
Synonyms:
TRAF3, Traf3
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4004059
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
TNF Receptor-Associated Factor 3 (TRAF3)
Gene ID:
7187 (Human, TRAF3)
Synonyms:
TRAF3, Traf3
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4000537
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
TNF Receptor-Associated Factor 3 (TRAF3)
Gene ID:
7187 (Human, TRAF3)
Synonyms:
TRAF3, Traf3
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4000538
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
TNF Receptor-Associated Factor 3 (TRAF3)
NCBI Accession:
NM_003300,NP_003291
Species:
Human
Synonyms:
TRAF3, Traf3
Insert length:
2600 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-XL5
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter, T7 Promoter
Expression:
Transient

Empty vector controls:
ABIN4948184

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3387422
$310.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
TNF Receptor-Associated Factor 3 (TRAF3)
NCBI Accession:
NM_001199427
Gene ID:
7187 (Human, TRAF3)
Synonyms:
TRAF3, Traf3
Insert length:
1458 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4921973
$319.00
10 μg
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
ISO 9001:2008

Type:
ORF
Application:
Protein Expression
Gene:
TNF Receptor-Associated Factor 3 (TRAF3)
NCBI Accession:
NM_003300
Gene ID:
7187 (Human, TRAF3)
Synonyms:
TRAF3, Traf3
Insert length:
1707 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pcDNA3.1+C-(K)-DYK
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient, Stable

Sequencing Primer:
    • Forward primer: 5'-TAATACGACTCACTATAGGG-3'
    • Reverse primer: 5'-CCTCGACTGTGCCTTCTA-3'
Components:
The GenEZ ORF clone is delivered as 10 μg of lyophilized plasmid DNA in a vial.
Format:
Lyophilized
Storage:
RT/-20 °C
Catalog No. ABIN4917677
$379.00
10 μg
Plus shipping costs $45.00
Delivery in 4 to 6 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
TNF Receptor-Associated Factor 3 (TRAF3)
NCBI Accession:
NM_011632
Species:
Mouse (Murine)
Synonyms:
TRAF3, Traf3
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Traf3
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5119932
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
TNF Receptor-Associated Factor 3 (TRAF3)
NCBI Accession:
NM_003300
Species:
Human
Synonyms:
TRAF3, Traf3
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of TRAF3
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5119930
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
TNF Receptor-Associated Factor 3 (TRAF3)
NCBI Accession:
NM_001108724
Species:
Rat (Rattus)
Synonyms:
TRAF3, Traf3
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Traf3
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5119934
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
ORF
Application:
Protein Expression
Gene:
TNF Receptor-Associated Factor 3 (TRAF3)
NCBI Accession:
NM_145725,NP_663777
Species:
Human
Synonyms:
TRAF3, Traf3
Insert length:
1707 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5403558
$420.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
TNF Receptor-Associated Factor 3 (TRAF3)
NCBI Accession:
NM_003300,NP_003291
Species:
Human
Synonyms:
TRAF3, Traf3
Insert length:
1707 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5403560
$420.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
TNF Receptor-Associated Factor 3 (TRAF3)
NCBI Accession:
NM_001199427,NP_001186356
Species:
Human
Synonyms:
TRAF3, Traf3
Insert length:
1458 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5403561
$420.00
10 μg
Plus shipping costs $45.00
Will be delivered in 71 Business Days

Application:
RNA Interference
Gene:
TNF Receptor-Associated Factor 3
Species:
Mouse (Murine)
Synonyms:
CAP-1, CAP1, CD40bp, CRAF1, IIAE5, LAP1, AI528849, T-BAM, amn
Purification:
HPLC purified
Sequence:
Available with shipment
Components:
  • Traf3 (Mouse) - 3 unique 27mer siRNA duplexes - 2 nmol each
  • Trilencer-27 Universal Scrambled Negative Control siRNA Duplex - 2 nmol
  • RNAse free siRNA Duplex Resuspension Buffer - 2 ml
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3264582
$430.00
1 kit
Plus shipping costs $45.00
Delivery in 4 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to TRAF3

  • TNF receptor associated factor 3 (TRAF3)
  • TNF receptor-associated factor 3 (Traf3)
  • Tnf receptor-associated factor 3 (Traf3)
  • AI528849
  • amn
  • CAP-1
  • CAP1
  • CD40bp
  • CRAF1
  • IIAE5
  • LAP1
  • T-BAM

Gene-IDs for different species

GENE IDSPECIES
7187 Homo sapiens
22031 Mus musculus
362788 Rattus norvegicus

Protein level used designations for TRAF3

  • CD40 associated protein 1
  • CD40 binding protein
  • CD40 receptor associated factor 1
  • LMP1-associated protein 1
  • CD40 receptor-associated factor 1
  • TRAFAMN
  • TNF receptor-associated factor 3
Other products related to TRAF3 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com