TRIB3 (Tribbles Homolog 3 (Drosophila), TRIB3)

Short Description: The protein encoded by this gene is a putative protein kinase that is induced by the transcription factor NF-kappaB. The encoded protein is a negative regulator of NF-kappaB and can also sensitize cells to TNF- and TRAIL-induced apoptosis. In addition, this protein can negatively regulate the cell survival serine-threonine kinase AKT1. [provided by RefSeq, Jul 2008].
More information related to gene TRIB3.
Products related to TRIB3 Gene:
139 Products
Data Quality
  • 1
Type
  • 133
  • 6
Species
  • 59
  • 47
  • 29
  • 2
  • 2
Application
  • 88
  • 30
  • 25
  • 18
  • 2
Fusion tag
  • 47
  • 18
  • 13
  • 12
  • 8
Vector Backbone
  • 8
  • 8
  • 8
  • 7
  • 6
Vector
  • 61
  • 42
  • 12
  • 9
  • 5
Insert
  • 53
  • 41
  • 21
  • 10
  • 6
Oligo-Type
  • 4
  • 2
Resistance Gene
  • 58
  • 46
  • 24
  • 5
  • 2
Expression Type
  • 101
  • 53
  • 26
Selectable Marker
  • 28
  • 26
  • 26
  • 1
Promoter
  • 42
  • 36
  • 33
  • 13
  • 10
Format
  • 68
  • 27
  • 26
  • 18

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Tribbles Homolog 3 (Drosophila) (TRIB3)
Gene ID:
405805 (Zebrafish (Danio rerio), TRIB3)
Synonyms:
trib3, TRIB3, Trib3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6.1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3877855
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Tribbles Homolog 3 (Drosophila) (TRIB3)
Gene ID:
57761 (Human, TRIB3)
Synonyms:
trib3, TRIB3, Trib3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3818227
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Tribbles Homolog 3 (Drosophila) (TRIB3)
Gene ID:
538465 (Cow (Bovine), TRIB3)
Synonyms:
trib3, TRIB3, Trib3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3863313
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Tribbles Homolog 3 (Drosophila) (TRIB3)
Gene ID:
228775 (Mouse (Murine), TRIB3)
Synonyms:
trib3, TRIB3, Trib3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3835909
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Tribbles Homolog 3 (Drosophila) (TRIB3)
Gene ID:
246273 (Rat (Rattus), TRIB3)
Synonyms:
trib3, TRIB3, Trib3
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4048607
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Tribbles Homolog 3 (Drosophila) (TRIB3)
Gene ID:
57761 (Human, TRIB3)
Synonyms:
trib3, TRIB3, Trib3
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4092378
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Tribbles Homolog 3 (Drosophila) (TRIB3)
NCBI Accession:
NM_021158
Species:
Human
Synonyms:
trib3, TRIB3, Trib3
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3607030
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Tribbles Homolog 3 (Drosophila) (TRIB3)
NCBI Accession:
NM_175093
Species:
Mouse (Murine)
Synonyms:
trib3, TRIB3, Trib3
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3607029
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Tribbles Homolog 3 (Drosophila)
Species:
Human
Synonyms:
zgc:76966, TRIB3, C20orf97, NIPK, SINK, SKIP3, TRB3, Ifld2, Nipk, TRB-3, Trb3
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3189004
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Tribbles Homolog 3 (Drosophila)
Species:
Mouse (Murine)
Synonyms:
zgc:76966, TRIB3, C20orf97, NIPK, SINK, SKIP3, TRB3, Ifld2, Nipk, TRB-3, Trb3
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3194415
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Tribbles Homolog 3 (Drosophila) (TRIB3)
Gene ID:
405805 (Zebrafish (Danio rerio), TRIB3)
Synonyms:
trib3, TRIB3, Trib3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3847276
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Tribbles Homolog 3 (Drosophila) (TRIB3)
Species:
Human
Synonyms:
trib3, TRIB3, Trib3
Insert length:
1077 bp
Vector type:
Cloning Vector
Vector backbone:
pORF
Resistance Gene:
Spectinomycin
Expression:
Transient

Sequencing Primer:
  • M13 FP: 5'-CCCAGTCACGACGTTGTAAAACG-3'
    M13 RP: 5'-CAGGAAACAGCTATGAC-3'
Format:
Liquid
Buffer:
10  mM Tris-HCI, 1  mM EDTA,  pH 8.0
Storage:
-20 °C
Catalog No. ABIN5732711
$84.00
1 μg
Plus shipping costs $45.00
Delivery in 3 to 4 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Tribbles Homolog 3 (Drosophila) (TRIB3)
Gene ID:
57761 (Human, TRIB3)
Synonyms:
trib3, TRIB3, Trib3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3818228
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Tribbles Homolog 3 (Drosophila) (TRIB3)
Gene ID:
538465 (Cow (Bovine), TRIB3)
Synonyms:
trib3, TRIB3, Trib3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3863314
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Tribbles Homolog 3 (Drosophila) (TRIB3)
Gene ID:
228775 (Mouse (Murine), TRIB3)
Synonyms:
trib3, TRIB3, Trib3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3835911
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Tribbles Homolog 3 (Drosophila) (TRIB3)
Gene ID:
246273 (Rat (Rattus), TRIB3)
Synonyms:
trib3, TRIB3, Trib3
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4048608
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Tribbles Homolog 3 (Drosophila) (TRIB3)
Gene ID:
57761 (Human, TRIB3)
Synonyms:
trib3, TRIB3, Trib3
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4092379
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Tribbles Homolog 3 (Drosophila) (TRIB3)
Gene ID:
57761 (Human, TRIB3)
Synonyms:
trib3, TRIB3, Trib3
Insert length:
1077 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5323294
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Tribbles Homolog 3 (Drosophila) (TRIB3)
NCBI Accession:
NM_175093
Species:
Mouse (Murine)
Synonyms:
trib3, TRIB3, Trib3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3607004
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Tribbles Homolog 3 (Drosophila) (TRIB3)
NCBI Accession:
NM_021158
Species:
Human
Synonyms:
trib3, TRIB3, Trib3
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-untagged
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948161

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3607027
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to TRIB3

  • tribbles pseudokinase 3 (trib3)
  • tribbles pseudokinase 3 (TRIB3)
  • tribbles pseudokinase 3 (Trib3)
  • C20orf97
  • Ifld2
  • NIPK
  • Nipk
  • SINK
  • SKIP3
  • TRB-3
  • TRB3
  • Trb3
  • TRIB3
  • zgc:76966

Gene-IDs for different species

GENE IDSPECIES
405805 Danio rerio
714636 Macaca mulatta
100439080 Pongo abelii
100603917 Nomascus leucogenys
745623 Pan troglodytes
57761 Homo sapiens
485819 Canis lupus familiaris
228775 Mus musculus
246273 Rattus norvegicus
538465 Bos taurus
100518810 Sus scrofa

Protein level used designations for TRIB3

  • tribbles homolog 3
  • tribbles homolog 3 (Drosophila)
  • tribbles homolog 3-like
  • TRB-3
  • neuronal cell death inducible putative kinase
  • neuronal cell death-inducible putative kinase
  • p65-interacting inhibitor of NF-kappa-B
  • p65-interacting inhibitor of NF-kappaB
  • induced in fatty liver dystrophy 2
  • Neuronal cell death Inducible Putative Kinase
  • kinase
  • tribbles 3
Other products related to TRIB3 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com