TSG101 (Tumor Susceptibility Gene 101, TSG101)

Short Description: The protein encoded by this gene belongs to a group of apparently inactive homologs of ubiquitin-conjugating enzymes. The gene product contains a coiled-coil domain that interacts with stathmin, a cytosolic phosphoprotein implicated in tumorigenesis. The protein may play a role in cell growth and differentiation and act as a negative growth regulator. In vitro steady-state expression of this tumor susceptibility gene appears to be important for maintenance of genomic stability and cell cycle regulation. Mutations and alternative splicing in this gene occur in high frequency in breast cancer and suggest that defects occur during breast cancer tumorigenesis and/or progression. [provided by RefSeq, Jul 2008].
More information related to gene TSG101.
Products related to TSG101 Gene:
121 Products
Data Quality
  • 1
  • 116
  • 5
  • 44
  • 40
  • 29
  • 2
  • 2
  • 71
  • 32
  • 25
  • 16
  • 1
Fusion tag
  • 46
  • 16
  • 11
  • 10
  • 8
Vector Backbone
  • 8
  • 6
  • 6
  • 6
  • 6
  • 48
  • 36
  • 12
  • 9
  • 6
  • 45
  • 34
  • 21
  • 8
  • 6
  • 4
  • 1
Resistance Gene
  • 47
  • 45
  • 22
  • 2
  • 2
Expression Type
  • 92
  • 50
  • 13
Selectable Marker
  • 26
  • 24
  • 13
  • 1
  • 31
  • 31
  • 30
  • 13
  • 8
  • 51
  • 24
  • 24
  • 22

Protein Expression
Tumor Susceptibility Gene 101 (TSG101)
NCBI Accession:
TSG101, tsg-101, tsg101, Tsg101, tsg101a, tsg101.L
Insert length:
1173 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
CMV Promoter
Fusion Tag:

Empty vector controls:

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
4 °C/-20 °C
Catalog No. ABIN5497816
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Tumor Susceptibility Gene 101 (TSG101)
Gene ID:
415179 (Zebrafish (Danio rerio), TSG101)
TSG101, tsg-101, tsg101, Tsg101, tsg101a, tsg101.L
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4041830
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Tumor Susceptibility Gene 101 (TSG101)
Gene ID:
22088 (Mouse (Murine), TSG101)
TSG101, tsg-101, tsg101, Tsg101, tsg101a, tsg101.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4217852
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Tumor Susceptibility Gene 101 (TSG101)
Gene ID:
22088 (Mouse (Murine), TSG101)
TSG101, tsg-101, tsg101, Tsg101, tsg101a, tsg101.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4217853
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Tumor Susceptibility Gene 101 (TSG101)
Gene ID:
7251 (Human, TSG101)
TSG101, tsg-101, tsg101, Tsg101, tsg101a, tsg101.L
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4087242
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Tumor Susceptibility Gene 101 (TSG101)
Gene ID:
292925 (Rat (Rattus), TSG101)
TSG101, tsg-101, tsg101, Tsg101, tsg101a, tsg101.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4050334
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Tumor Susceptibility Gene 101 (TSG101)
Gene ID:
446571 (Xenopus laevis, TSG101)
TSG101, tsg-101, tsg101, Tsg101, tsg101a, tsg101.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3851260
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Tumor Susceptibility Gene 101 (TSG101)
Gene ID:
507659 (Cow (Bovine), TSG101)
TSG101, tsg-101, tsg101, Tsg101, tsg101a, tsg101.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3855522
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Tumor Susceptibility Gene 101 (TSG101)
Gene ID:
394879 (Xenopus tropicalis, TSG101)
TSG101, tsg-101, tsg101, Tsg101, tsg101a, tsg101.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3882084
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Tumor Susceptibility Gene 101 (TSG101)
NCBI Accession:
TSG101, tsg-101, tsg101, Tsg101, tsg101a, tsg101.L
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13(-21)
  • M13 rev
Catalog No. ABIN3566310
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Tumor Susceptibility Gene 101 (TSG101)
NCBI Accession:
Mouse (Murine)
TSG101, tsg-101, tsg101, Tsg101, tsg101a, tsg101.L
Vector type:
TA-Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Catalog No. ABIN3566309
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Tumor Susceptibility Gene 101 (TSG101)
NCBI Accession:
Rat (Rattus)
TSG101, tsg-101, tsg101, Tsg101, tsg101a, tsg101.L
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • M13(-21)
  • M13 rev
Catalog No. ABIN3566311
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Quantitative real-time PCR
Tumor Susceptibility Gene 101
Mouse (Murine)
CG9712, DmTSG101, Dmel\\CG9712, ESCRT-I, Tsg101, burs, dTSg101, dTsg101, dVps23, ept, tsg101, vps23, TSG101, MGC76193, TSG10, VPS23, AI255943, CC2, Rw, zgc:86926
-20 °C
Catalog No. ABIN3195580
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Tumor Susceptibility Gene 101 (TSG101)
Gene ID:
415179 (Zebrafish (Danio rerio), TSG101)
TSG101, tsg-101, tsg101, Tsg101, tsg101a, tsg101.L
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • M13(-21)
Glycerol Stock
-80 °C
Catalog No. ABIN4041831
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Tumor Susceptibility Gene 101 (TSG101)
Gene ID:
22088 (Mouse (Murine), TSG101)
TSG101, tsg-101, tsg101, Tsg101, tsg101a, tsg101.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4217854
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Tumor Susceptibility Gene 101 (TSG101)
Gene ID:
22088 (Mouse (Murine), TSG101)
TSG101, tsg-101, tsg101, Tsg101, tsg101a, tsg101.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4217851
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Tumor Susceptibility Gene 101 (TSG101)
Gene ID:
7251 (Human, TSG101)
TSG101, tsg-101, tsg101, Tsg101, tsg101a, tsg101.L
Vector type:
Cloning Vector
Vector backbone:
Resistance Gene:

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4087243
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Tumor Susceptibility Gene 101 (TSG101)
Gene ID:
292925 (Rat (Rattus), TSG101)
TSG101, tsg-101, tsg101, Tsg101, tsg101a, tsg101.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN4050333
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Tumor Susceptibility Gene 101 (TSG101)
Gene ID:
446571 (Xenopus laevis, TSG101)
TSG101, tsg-101, tsg101, Tsg101, tsg101a, tsg101.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3851261
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Protein Expression, Cloning
Tumor Susceptibility Gene 101 (TSG101)
Gene ID:
507659 (Cow (Bovine), TSG101)
TSG101, tsg-101, tsg101, Tsg101, tsg101a, tsg101.L
Vector type:
Mammalian Expression Vector
Vector backbone:
Resistance Gene:
Enhanced CMV Promoter

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Glycerol Stock
-80 °C
Catalog No. ABIN3855520
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to TSG101

  • tumor susceptibility 101 (TSG101)
  • Tumor susceptibility gene 101 (TSG101)
  • Tumor Susceptibility Gene homolog (tsg-101)
  • tumor susceptibility 101 (tsg101)
  • tumor susceptibility gene 101 (Tsg101)
  • tumor susceptibility gene 101 (TSG101)
  • tumor susceptibility 101 (Tsg101)
  • tumor susceptibility 101a (tsg101a)
  • tumor susceptibility 101 L homeolog (tsg101.L)
  • AI255943
  • burs
  • CC2
  • CG9712
  • Dmel\\CG9712
  • DmTSG101
  • dTSg101
  • dTsg101
  • dVps23
  • ept
  • MGC76193
  • Rw
  • TSG10
  • tsg101
  • TSG101
  • Tsg101
  • VPS23
  • vps23
  • zgc:86926

Gene-IDs for different species

100057099 Equus caballus
39881 Drosophila melanogaster
182474 Caenorhabditis elegans
693787 Macaca mulatta
451065 Pan troglodytes
394879 Xenopus (Silurana) tropicalis
100172234 Pongo abelii
7251 Homo sapiens
22088 Mus musculus
423082 Gallus gallus
485406 Canis lupus familiaris
507659 Bos taurus
292925 Rattus norvegicus
415179 Danio rerio
446571 Xenopus laevis

Protein level used designations for TSG101

  • CG9712-PA
  • TSG101-PA
  • erupted
  • tumor susceptibility Gene-101
  • Tumor Susceptibility Gene homolog family member (tsg-101)
  • ESCRT-I complex subunit TSG101
  • tumor susceptibility gene 101 protein
  • tumor susceptibility protein 101
  • tumor susceptibility gene 101
  • tumor susceptibility gene 10
  • tumor susceptibility protein
  • Tumor supressor
Other products related to TSG101 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com