TSG101 (Tumor Susceptibility Gene 101, TSG101)

Short Description: The protein encoded by this gene belongs to a group of apparently inactive homologs of ubiquitin-conjugating enzymes. The gene product contains a coiled-coil domain that interacts with stathmin, a cytosolic phosphoprotein implicated in tumorigenesis. The protein may play a role in cell growth and differentiation and act as a negative growth regulator. In vitro steady-state expression of this tumor susceptibility gene appears to be important for maintenance of genomic stability and cell cycle regulation. Mutations and alternative splicing in this gene occur in high frequency in breast cancer and suggest that defects occur during breast cancer tumorigenesis and/or progression. [provided by RefSeq, Jul 2008].
More information related to gene TSG101.
Products related to TSG101 Gene:
Data Quality
  • 1
Type
  • 113
  • 4
Species
  • 43
  • 38
  • 28
  • 2
  • 2
Application
  • 71
  • 32
  • 21
  • 16
  • 1
Fusion tag
  • 45
  • 13
  • 11
  • 10
  • 8
Vector Backbone
  • 8
  • 6
  • 6
  • 6
  • 6
Vector
  • 45
  • 36
  • 12
  • 9
  • 6
Insert
  • 45
  • 34
  • 18
  • 8
  • 6
Oligo-Type
  • 3
  • 1
Resistance Gene
  • 45
  • 44
  • 22
  • 2
  • 2
Expression Type
  • 89
  • 47
  • 13
Selectable Marker
  • 26
  • 21
  • 13
  • 1
Promoter
  • 30
  • 28
  • 28
  • 13
  • 8
Format
  • 47
  • 24
  • 24
  • 22
117 Products

Type:
ORF
Application:
Protein Expression
Gene:
Tumor Susceptibility Gene 101 (TSG101)
NCBI Accession:
NM_006292,NP_006283
Species:
Human
Synonyms:
TSG101, tsg-101, tsg101, Tsg101, tsg101a, tsg101.L
Insert length:
1173 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5497816
$98.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Tumor Susceptibility Gene 101 (TSG101)
Gene ID:
415179 (Zebrafish (Danio rerio), TSG101)
Synonyms:
TSG101, tsg-101, tsg101, Tsg101, tsg101a, tsg101.L
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4041830
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Tumor Susceptibility Gene 101 (TSG101)
Gene ID:
446571 (Xenopus laevis, TSG101)
Synonyms:
TSG101, tsg-101, tsg101, Tsg101, tsg101a, tsg101.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3851260
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Tumor Susceptibility Gene 101 (TSG101)
Gene ID:
394879 (Xenopus tropicalis, TSG101)
Synonyms:
TSG101, tsg-101, tsg101, Tsg101, tsg101a, tsg101.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3882084
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Tumor Susceptibility Gene 101 (TSG101)
Gene ID:
7251 (Human, TSG101)
Synonyms:
TSG101, tsg-101, tsg101, Tsg101, tsg101a, tsg101.L
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4087242
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Tumor Susceptibility Gene 101 (TSG101)
Gene ID:
22088 (Mouse, TSG101)
Synonyms:
TSG101, tsg-101, tsg101, Tsg101, tsg101a, tsg101.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4217852
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Tumor Susceptibility Gene 101 (TSG101)
Gene ID:
22088 (Mouse, TSG101)
Synonyms:
TSG101, tsg-101, tsg101, Tsg101, tsg101a, tsg101.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4217853
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Tumor Susceptibility Gene 101 (TSG101)
Gene ID:
507659 (Cow, TSG101)
Synonyms:
TSG101, tsg-101, tsg101, Tsg101, tsg101a, tsg101.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3855522
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Tumor Susceptibility Gene 101 (TSG101)
Gene ID:
292925 (Rat, TSG101)
Synonyms:
TSG101, tsg-101, tsg101, Tsg101, tsg101a, tsg101.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4050334
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Tumor Susceptibility Gene 101 (TSG101)
NCBI Accession:
NM_006292
Species:
Human
Synonyms:
TSG101, tsg-101, tsg101, Tsg101, tsg101a, tsg101.L
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3566310
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Tumor Susceptibility Gene 101 (TSG101)
NCBI Accession:
NM_021884
Species:
Mouse
Synonyms:
TSG101, tsg-101, tsg101, Tsg101, tsg101a, tsg101.L
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3566309
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Tumor Susceptibility Gene 101 (TSG101)
NCBI Accession:
NM_181628
Species:
Rat
Synonyms:
TSG101, tsg-101, tsg101, Tsg101, tsg101a, tsg101.L
Vector type:
Cloning Vector
Vector backbone:
pUC19
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13(-21)
  • M13 rev
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3566311
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Tumor Susceptibility Gene 101
Species:
Mouse
Synonyms:
CG9712, DmTSG101, Dmel\\CG9712, ESCRT-I, Tsg101, burs, dTSg101, dTsg101, dVps23, ept, tsg101, vps23, TSG101, MGC76193, TSG10, VPS23, AI255943, CC2, Rw, zgc:86926
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3195580
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Tumor Susceptibility Gene 101 (TSG101)
Gene ID:
415179 (Zebrafish (Danio rerio), TSG101)
Synonyms:
TSG101, tsg-101, tsg101, Tsg101, tsg101a, tsg101.L
Vector type:
Cloning Vector
Vector backbone:
pDNR-LIB
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • M13(-21)
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4041831
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Tumor Susceptibility Gene 101 (TSG101)
Gene ID:
446571 (Xenopus laevis, TSG101)
Synonyms:
TSG101, tsg-101, tsg101, Tsg101, tsg101a, tsg101.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3851261
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Tumor Susceptibility Gene 101 (TSG101)
Gene ID:
394879 (Xenopus tropicalis, TSG101)
Synonyms:
TSG101, tsg-101, tsg101, Tsg101, tsg101a, tsg101.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3882083
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Tumor Susceptibility Gene 101 (TSG101)
Gene ID:
7251 (Human, TSG101)
Synonyms:
TSG101, tsg-101, tsg101, Tsg101, tsg101a, tsg101.L
Vector type:
Cloning Vector
Vector backbone:
pOTB7
Resistance Gene:
Chloramphenicol

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4087243
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Tumor Susceptibility Gene 101 (TSG101)
Gene ID:
22088 (Mouse, TSG101)
Synonyms:
TSG101, tsg-101, tsg101, Tsg101, tsg101a, tsg101.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4217851
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Tumor Susceptibility Gene 101 (TSG101)
Gene ID:
22088 (Mouse, TSG101)
Synonyms:
TSG101, tsg-101, tsg101, Tsg101, tsg101a, tsg101.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4217854
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Tumor Susceptibility Gene 101 (TSG101)
Gene ID:
507659 (Cow, TSG101)
Synonyms:
TSG101, tsg-101, tsg101, Tsg101, tsg101a, tsg101.L
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3855520
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days
  • <
  • 1

Synonyms and alternative names related to TSG101

  • tumor susceptibility 101 (TSG101)
  • Tumor susceptibility gene 101 (TSG101)
  • Tumor Susceptibility Gene homolog (tsg-101)
  • tumor susceptibility 101 (tsg101)
  • tumor susceptibility gene 101 (Tsg101)
  • tumor susceptibility gene 101 (TSG101)
  • tumor susceptibility 101 (Tsg101)
  • tumor susceptibility 101a (tsg101a)
  • tumor susceptibility 101 L homeolog (tsg101.L)
  • AI255943
  • burs
  • CC2
  • CG9712
  • Dmel\\CG9712
  • DmTSG101
  • dTSg101
  • dTsg101
  • dVps23
  • ept
  • ESCRT-I
  • MGC76193
  • Rw
  • TSG10
  • tsg101
  • TSG101
  • Tsg101
  • VPS23
  • vps23
  • zgc:86926

Gene-IDs for different species

GENE IDSPECIES
100057099 Equus caballus
39881 Drosophila melanogaster
182474 Caenorhabditis elegans
693787 Macaca mulatta
451065 Pan troglodytes
394879 Xenopus (Silurana) tropicalis
100172234 Pongo abelii
7251 Homo sapiens
22088 Mus musculus
423082 Gallus gallus
485406 Canis lupus familiaris
507659 Bos taurus
292925 Rattus norvegicus
415179 Danio rerio
446571 Xenopus laevis

Protein level used designations for TSG101

  • CG9712-PA
  • TSG101-PA
  • erupted
  • tumor susceptibility Gene-101
  • Tumor Susceptibility Gene homolog family member (tsg-101)
  • ESCRT-I complex subunit TSG101
  • tumor susceptibility gene 101 protein
  • tumor susceptibility protein 101
  • tumor susceptibility gene 101
  • tumor susceptibility gene 10
  • tumor susceptibility protein
  • Tumor supressor
Other products related to TSG101 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com