UNC93B1 (Unc-93 Homolog B1 (C. Elegans), UNC93B1)

Short Description: This gene encodes a protein with similarity to the C. elegans unc93 protein. The Unc93 protein is involved in the regulation or coordination of muscle contraction in the worm. [provided by RefSeq, Jul 2008].
More information related to gene UNC93B1.
Products related to UNC93B1 Gene:
111 Products
Data Quality
  • 1
Type
  • 109
  • 2
Species
  • 45
  • 39
  • 25
  • 2
Application
  • 59
  • 32
  • 22
  • 16
Fusion tag
  • 38
  • 17
  • 12
  • 12
  • 8
Vector Backbone
  • 8
  • 8
  • 6
  • 6
  • 6
Vector
  • 39
  • 34
  • 16
  • 10
  • 9
Insert
  • 48
  • 25
  • 20
  • 8
  • 6
Oligo-Type
  • 2
Resistance Gene
  • 42
  • 40
  • 22
  • 5
  • 2
Expression Type
  • 102
  • 52
  • 2
Selectable Marker
  • 33
  • 26
Promoter
  • 38
  • 30
  • 17
  • 12
  • 8
Format
  • 36
  • 34
  • 24
  • 17

Type:
cDNA
Application:
Cloning
Gene:
Unc-93 Homolog B1 (C. Elegans) (UNC93B1)
Gene ID:
81622 (Human, UNC93B1)
Synonyms:
UNC93B1, Unc93b1
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4213344
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Unc-93 Homolog B1 (C. Elegans) (UNC93B1)
Gene ID:
81622 (Human, UNC93B1)
Synonyms:
UNC93B1, Unc93b1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4009791
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Unc-93 Homolog B1 (C. Elegans) (UNC93B1)
Gene ID:
81622 (Human, UNC93B1)
Synonyms:
UNC93B1, Unc93b1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4009792
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Unc-93 Homolog B1 (C. Elegans) (UNC93B1)
Gene ID:
54445 (Mouse (Murine), UNC93B1)
Synonyms:
UNC93B1, Unc93b1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3815537
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Unc-93 Homolog B1 (C. Elegans) (UNC93B1)
Gene ID:
54445 (Mouse (Murine), UNC93B1)
Synonyms:
UNC93B1, Unc93b1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3815533
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Unc-93 Homolog B1 (C. Elegans) (UNC93B1)
Gene ID:
100101743 (Xenopus tropicalis, UNC93B1)
Synonyms:
UNC93B1, Unc93b1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS108
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4031550
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Unc-93 Homolog B1 (C. Elegans) (UNC93B1)
Gene ID:
81622 (Human, UNC93B1)
Synonyms:
UNC93B1, Unc93b1
Vector type:
Cloning Vector
Vector backbone:
pBluescriptR
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4213345
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Unc-93 Homolog B1 (C. Elegans) (UNC93B1)
Gene ID:
81622 (Human, UNC93B1)
Synonyms:
UNC93B1, Unc93b1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4009790
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Unc-93 Homolog B1 (C. Elegans) (UNC93B1)
Gene ID:
81622 (Human, UNC93B1)
Synonyms:
UNC93B1, Unc93b1
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4009793
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Unc-93 Homolog B1 (C. Elegans) (UNC93B1)
Gene ID:
54445 (Mouse (Murine), UNC93B1)
Synonyms:
UNC93B1, Unc93b1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3815534
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Unc-93 Homolog B1 (C. Elegans) (UNC93B1)
Gene ID:
54445 (Mouse (Murine), UNC93B1)
Synonyms:
UNC93B1, Unc93b1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3815538
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Unc-93 Homolog B1 (C. Elegans) (UNC93B1)
Gene ID:
100101743 (Xenopus tropicalis, UNC93B1)
Synonyms:
UNC93B1, Unc93b1
Vector type:
Mammalian Expression Vector
Vector backbone:
pCS108
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient, in vitro Transcription

Sequencing Primer:
  • T7
  • T3
  • Sp6
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4031551
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Unc-93 Homolog B1 (C. Elegans) (UNC93B1)
Species:
Human
Synonyms:
UNC93B1, Unc93b1
Insert length:
1794 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-GST
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-GST
Expression:
Transient

Sequencing Primer:
  • GST Forward primer: 5'-CACGTTTGGTGGTGGCGAC3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4842885
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Unc-93 Homolog B1 (C. Elegans) (UNC93B1)
Species:
Human
Synonyms:
UNC93B1, Unc93b1
Insert length:
1794 bp
Vector type:
Bacterial Expression Vector
Vector backbone:
pPB-His-MBP
Resistance Gene:
Kanamycin
Promoter:
T7 Promoter
Fusion Tag:
His-MBP
Expression:
Transient

Sequencing Primer:
  • MBP Forward primer: 5'-CGCAGATGTCCGCTTTCTGG-3'
  • T7 terminator primer: 5'-GCTAGTTATTGCTCAGCGG-3'
Format:
Liquid
Buffer:
10 mM Tris-HCI, 1 mM EDTA, pH 8.0
Storage:
-20 °C
Catalog No. ABIN4713754
$300.00
500 ng
Plus shipping costs $45.00
Delivery in 11 to 21 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Unc-93 Homolog B1 (C. Elegans) (UNC93B1)
Gene ID:
81622 (Human, UNC93B1)
Synonyms:
UNC93B1, Unc93b1
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • M13pUC-fwd
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3413576
$308.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Unc-93 Homolog B1 (C. Elegans) (UNC93B1)
NCBI Accession:
NM_030930,NP_112192
Species:
Human
Synonyms:
UNC93B1, Unc93b1
Insert length:
1794 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Promoter:
CMV Promoter
Fusion Tag:
Myc-DYKDDDDK Tag
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
The ORF clone is ion-exchange column purified, transfection-ready dried plasmid DNA, and shipped with 2 vector sequencing primers.
Format:
Lyophilized
Storage:
4 °C/-20 °C
Catalog No. ABIN5409329
$420.00
10 μg
Plus shipping costs $45.00
Delivery in 8 to 10 Business Days

Type:
cDNA
Application:
Protein Expression
Gene:
Unc-93 Homolog B1 (C. Elegans) (UNC93B1)
NCBI Accession:
NM_001161428,NP_001154900
Species:
Mouse (Murine)
Synonyms:
UNC93B1, Unc93b1
Insert length:
1269 bp
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV6-Entry
Resistance Gene:
Kanamycin
Selection Marker:
Neomycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Empty vector controls:
ABIN4948181

Sequencing Primer:
  • VP1.5 (forward) 5'GGACTTTCCAAAATGTCG 3'
  • XL39 (reverse) 5'ATTAGGACAAGGCTGGTGGG 3'
Components:
  • The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA.
  • The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Format:
Lyophilized
Storage:
RT,-20 °C
Catalog No. ABIN3338797
$420.00
10 μg
Plus shipping costs $45.00
Will be delivered in 21 Business Days

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Unc-93 Homolog B1 (C. Elegans) (UNC93B1)
NCBI Accession:
NM_030930
Species:
Human
Synonyms:
UNC93B1, Unc93b1
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of UNC93B1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5123244
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Unc-93 Homolog B1 (C. Elegans) (UNC93B1)
NCBI Accession:
NM_001108513
Species:
Rat (Rattus)
Synonyms:
UNC93B1, Unc93b1
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Unc93b1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5123248
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available

Type:
gRNA
Application:
Genome Editing with Engineered Nucleases, Protein Expression
Gene:
Unc-93 Homolog B1 (C. Elegans) (UNC93B1)
NCBI Accession:
NM_019449
Species:
Mouse (Murine)
Synonyms:
UNC93B1, Unc93b1
Vector type:
Lentiviral Vector
Vector backbone:
pLenti-U6-sgRNA-PGK-Neo
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin
Promoter:
U6 Promoter, PGK Promoter
Expression:
Stable, Transient

Components:
Lentiviral particles with an individual gRNA (300 μL) for a specific sequence of Unc93b1
Format:
Viral Particles
Storage:
-80 °C
Catalog No. ABIN5123246
$420.00
300 μL
Plus shipping costs $45.00 and $22.00 dry ice
Available
  • <
  • 1

Synonyms and alternative names related to UNC93B1

  • unc-93 homolog B1, TLR signaling regulator (UNC93B1)
  • unc-93 homolog B1 (C. elegans) (UNC93B1)
  • unc-93 homolog B1 (C. elegans) (Unc93b1)
  • unc-93 homolog B1, TLR signaling regulator (Unc93b1)
  • IIAE1
  • Unc-93B1
  • UNC93
  • UNC93B
  • Unc93b

Gene-IDs for different species

GENE IDSPECIES
483692 Canis lupus familiaris
710928 Macaca mulatta
100059773 Equus caballus
100582643 Nomascus leucogenys
746130 Pan troglodytes
395244 Gallus gallus
81622 Homo sapiens
508878 Bos taurus
54445 Mus musculus
361689 Rattus norvegicus

Protein level used designations for UNC93B1

  • unc-93 homolog B1 (C. elegans)
  • protein unc-93 homolog B1
  • unc-93 related protein
  • hUNC93B1
  • unc93 homolog B
  • unc93 homolog B1
  • unc-93 homolog B
Other products related to UNC93B1 such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com