VEGFC (Vascular Endothelial Growth Factor C, VEGFC)

Short Description: The protein encoded by this gene is a member of the platelet-derived growth factor/vascular endothelial growth factor (PDGF/VEGF) family, is active in angiogenesis and endothelial cell growth, and can also affect the permeability of blood vessels. This secreted protein undergoes a complex proteolytic maturation, generating multiple processed forms which bind and activate VEGFR-3 receptors. Only the fully processed form can bind and activate VEGFR-2 receptors. This protein is structurally and functionally similar to vascular endothelial growth factor D. [provided by RefSeq, Jul 2008].
More information related to gene VEGFC.
Products related to VEGFC Gene:
137 Products
Data Quality
  • 2
Type
  • 130
  • 7
Species
  • 54
  • 41
  • 39
  • 2
  • 1
Application
  • 88
  • 25
  • 25
  • 16
  • 3
Fusion tag
  • 45
  • 16
  • 15
  • 10
  • 9
Vector Backbone
  • 6
  • 6
  • 6
  • 6
  • 6
Vector
  • 65
  • 35
  • 12
  • 9
  • 5
Insert
  • 54
  • 39
  • 21
  • 8
  • 6
Oligo-Type
  • 4
  • 3
Resistance Gene
  • 68
  • 43
  • 18
  • 2
  • 1
Expression Type
  • 88
  • 49
  • 33
Selectable Marker
  • 33
  • 26
  • 25
Promoter
  • 46
  • 31
  • 31
  • 13
  • 8
Format
  • 74
  • 24
  • 22
  • 17

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Vascular Endothelial Growth Factor C (VEGFC)
Gene ID:
403049 (Zebrafish (Danio rerio), VEGFC)
Synonyms:
vegfc, VEGFC, vegfc.S, Vegfc
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4057143
$107.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Vascular Endothelial Growth Factor C (VEGFC)
Gene ID:
7424 (Human, VEGFC)
Synonyms:
vegfc, VEGFC, vegfc.S, Vegfc
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3805776
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Vascular Endothelial Growth Factor C (VEGFC)
Gene ID:
7424 (Human, VEGFC)
Synonyms:
vegfc, VEGFC, vegfc.S, Vegfc
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3878799
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Vascular Endothelial Growth Factor C (VEGFC)
Gene ID:
734331 (Xenopus laevis, VEGFC)
Synonyms:
vegfc, VEGFC, vegfc.S, Vegfc
Vector type:
Cloning Vector
Vector backbone:
pBluescript SK-
Resistance Gene:
Ampicillin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3468845
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Vascular Endothelial Growth Factor C (VEGFC)
Gene ID:
22341 (Mouse (Murine), VEGFC)
Synonyms:
vegfc, VEGFC, vegfc.S, Vegfc
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4218047
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Vascular Endothelial Growth Factor C (VEGFC)
NCBI Accession:
NM_005429
Species:
Human
Synonyms:
vegfc, VEGFC, vegfc.S, Vegfc
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3572470
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Vascular Endothelial Growth Factor C (VEGFC)
NCBI Accession:
NM_009506
Species:
Mouse (Murine)
Synonyms:
vegfc, VEGFC, vegfc.S, Vegfc
Vector type:
TA-Cloning Vector
Vector backbone:
pMD18-T Simple
Resistance Gene:
Ampicillin

Sequencing Primer:
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3572505
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Vascular Endothelial Growth Factor C (VEGFC)
NCBI Accession:
NM_053653
Species:
Rat (Rattus)
Synonyms:
vegfc, VEGFC, vegfc.S, Vegfc
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3572504
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
cDNA
Application:
Cloning
Gene:
Vascular Endothelial Growth Factor C (VEGFC)
NCBI Accession:
NM_005429
Species:
Human
Synonyms:
vegfc, VEGFC, vegfc.S, Vegfc
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3572503
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
Vascular Endothelial Growth Factor C
Species:
Human
Synonyms:
VEGFC, vegf-c, xvegf-c, Flt4-L, VRP, AW228853, VEGF-C
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3188893
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Vascular Endothelial Growth Factor C
Species:
Rat (Rattus)
Synonyms:
VEGFC, vegf-c, xvegf-c, Flt4-L, VRP, AW228853, VEGF-C
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3196263
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Application:
Quantitative real-time PCR
Gene:
Vascular Endothelial Growth Factor C
Species:
Mouse (Murine)
Synonyms:
VEGFC, vegf-c, xvegf-c, Flt4-L, VRP, AW228853, VEGF-C
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3193966
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Vascular Endothelial Growth Factor C (VEGFC)
Gene ID:
403049 (Zebrafish (Danio rerio), VEGFC)
Synonyms:
vegfc, VEGFC, vegfc.S, Vegfc
Vector type:
Mammalian Expression Vector
Vector backbone:
pExpress-1
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4057142
$147.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Vascular Endothelial Growth Factor C (VEGFC)
Gene ID:
7424 (Human, VEGFC)
Synonyms:
vegfc, VEGFC, vegfc.S, Vegfc
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3805775
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Vascular Endothelial Growth Factor C (VEGFC)
Gene ID:
7424 (Human, VEGFC)
Synonyms:
vegfc, VEGFC, vegfc.S, Vegfc
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6ccdB
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3878801
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
Vascular Endothelial Growth Factor C (VEGFC)
Gene ID:
22341 (Mouse (Murine), VEGFC)
Synonyms:
vegfc, VEGFC, vegfc.S, Vegfc
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4218048
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Cloning
Gene:
Vascular Endothelial Growth Factor C (VEGFC)
Gene ID:
7424 (Human, VEGFC)
Synonyms:
vegfc, VEGFC, vegfc.S, Vegfc
Insert length:
1260 bp
Vector type:
Gateway Cloning Vector
Vector backbone:
pDONR223
Resistance Gene:
Spectinomycin

Sequencing Primer:
  • Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT
  • Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Components:
2 μg of lyophilized gene in pDONR223 vector
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN5317084
$194.53
2 μg
Plus shipping costs $45.00
Delivery in 15 to 17 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Vascular Endothelial Growth Factor C (VEGFC)
NCBI Accession:
NM_009506
Species:
Mouse (Murine)
Synonyms:
vegfc, VEGFC, vegfc.S, Vegfc
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3572471
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Vascular Endothelial Growth Factor C (VEGFC)
NCBI Accession:
NM_053653
Species:
Rat (Rattus)
Synonyms:
vegfc, VEGFC, vegfc.S, Vegfc
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3572472
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
Vascular Endothelial Growth Factor C (VEGFC)
NCBI Accession:
NM_053653
Species:
Rat (Rattus)
Synonyms:
vegfc, VEGFC, vegfc.S, Vegfc
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948164

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3572484
$279.41
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to VEGFC

  • vascular endothelial growth factor c (vegfc)
  • vascular endothelial growth factor C (VEGFC)
  • vascular endothelial growth factor C S homeolog (vegfc.S)
  • vascular endothelial growth factor C (Vegfc)
  • AW228853
  • Flt4-L
  • vegf-c
  • VEGF-C
  • VEGFC
  • VRP
  • xvegf-c

Gene-IDs for different species

GENE IDSPECIES
403049 Danio rerio
699502 Macaca mulatta
100380462 Salmo salar
734331 Xenopus laevis
100127470 Sus scrofa
7424 Homo sapiens
22341 Mus musculus
114111 Rattus norvegicus
100338211 Oryctolagus cuniculus
100724469 Cavia porcellus
282122 Bos taurus
482932 Canis lupus familiaris
422573 Gallus gallus
101105629 Ovis aries
100525960 Sus scrofa

Protein level used designations for VEGFC

  • vascular endothelial growth factor C
  • vascular endothelial growth factor c
  • FLT4 ligand DHM
  • VEGF-C
  • vascular endothelial growth factor-related protein
  • VRP
  • flt4 ligand
  • flt4-L
  • vascular endothelial growth factor C isoform 129
  • vascular endothelial growth factor C isoform 184
Other products related to VEGFC such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com