VGF (VGF Nerve Growth Factor Inducible, VGF)

Short Description: This gene is specifically expressed in a subpopulation of neuroendocrine cells, and is upregulated by nerve growth factor. The structural organization of this gene is similar to that of the rat gene, and both the translated and the untranslated regions show a high degree of sequence similarity to the rat gene. The encoded secretory protein also shares similarities with the secretogranin/chromogranin family, however, its exact function is not known. [provided by RefSeq, Jul 2008].
More information related to gene VGF.
Products related to VGF Gene:
99 Products
Data Quality
  • 1
Type
  • 95
  • 4
Species
  • 42
  • 31
  • 26
Application
  • 54
  • 23
  • 20
  • 16
  • 1
Fusion tag
  • 31
  • 14
  • 11
  • 9
  • 8
Vector Backbone
  • 6
  • 6
  • 6
  • 5
  • 5
Vector
  • 36
  • 33
  • 12
  • 9
  • 4
Insert
  • 35
  • 24
  • 20
  • 8
  • 6
Oligo-Type
  • 3
  • 1
Resistance Gene
  • 43
  • 36
  • 16
  • 2
Expression Type
  • 79
  • 48
  • 11
Selectable Marker
  • 28
  • 26
  • 11
Promoter
  • 30
  • 27
  • 19
  • 12
  • 8
Format
  • 44
  • 24
  • 20
  • 11

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
VGF Nerve Growth Factor Inducible (VGF)
Gene ID:
7425 (Human, VGF)
Synonyms:
VGF, Vgf
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3465376
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
VGF Nerve Growth Factor Inducible (VGF)
Gene ID:
7425 (Human, VGF)
Synonyms:
VGF, Vgf
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3805777
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
VGF Nerve Growth Factor Inducible (VGF)
Gene ID:
381677 (Mouse (Murine), VGF)
Synonyms:
VGF, Vgf
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4018394
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
VGF Nerve Growth Factor Inducible (VGF)
Gene ID:
381677 (Mouse (Murine), VGF)
Synonyms:
VGF, Vgf
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4018395
$118.00
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
VGF Nerve Growth Factor Inducible (VGF)
NCBI Accession:
NM_001039385
Species:
Mouse (Murine)
Synonyms:
VGF, Vgf
Vector type:
TA-Cloning Vector
Vector backbone:
pGEM-T
Resistance Gene:
Ampicillin

Sequencing Primer:
  • SP6 and T7
  • M13-47 and RV-M
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3572517
$138.24
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Application:
Quantitative real-time PCR
Gene:
VGF Nerve Growth Factor Inducible
Species:
Mouse (Murine)
Synonyms:
VGF, Gm1052
Format:
Lyophilized
Storage:
-20 °C
Catalog No. ABIN3195146
$142.94
1 vial
Plus shipping costs $45.00
Delivery in 15 to 19 Business Days

Type:
cDNA
Application:
Protein Expression, Cloning
Gene:
VGF Nerve Growth Factor Inducible (VGF)
Gene ID:
7425 (Human, VGF)
Synonyms:
VGF, Vgf
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV-SPORT6
Resistance Gene:
Ampicillin
Promoter:
Enhanced CMV Promoter
Expression:
Transient

Sequencing Primer:
  • T7
  • Sp6
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN3465374
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
VGF Nerve Growth Factor Inducible (VGF)
Gene ID:
381677 (Mouse (Murine), VGF)
Synonyms:
VGF, Vgf
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4018392
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
cDNA
Application:
Cloning
Gene:
VGF Nerve Growth Factor Inducible (VGF)
Gene ID:
381677 (Mouse (Murine), VGF)
Synonyms:
VGF, Vgf
Vector type:
Cloning Vector
Vector backbone:
pCR4-TOPO
Resistance Gene:
Ampicillin
Selection Marker:
Neomycin

Sequencing Primer:
  • T7
  • T3
  • M13(-21)
  • M13 rev
Format:
Glycerol Stock
Storage:
-80 °C
Catalog No. ABIN4018393
$162.44
1 vial
Plus shipping costs $45.00
Delivery in 6 to 8 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
VGF Nerve Growth Factor Inducible (VGF)
NCBI Accession:
NM_001039385
Species:
Mouse (Murine)
Synonyms:
VGF, Vgf
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948162

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3572506
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
VGF Nerve Growth Factor Inducible (VGF)
NCBI Accession:
NM_001039385
Species:
Mouse (Murine)
Synonyms:
VGF, Vgf
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948163

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3572508
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
VGF Nerve Growth Factor Inducible (VGF)
NCBI Accession:
NM_001039385
Species:
Mouse (Murine)
Synonyms:
VGF, Vgf
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948165

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3572509
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 11 to 13 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
VGF Nerve Growth Factor Inducible (VGF)
NCBI Accession:
NM_001039385
Species:
Mouse (Murine)
Synonyms:
VGF, Vgf
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948164

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3572510
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
VGF Nerve Growth Factor Inducible (VGF)
NCBI Accession:
NM_001039385
Species:
Mouse (Murine)
Synonyms:
VGF, Vgf
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-FLAG
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
DYKDDDDK Tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948170

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3572512
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
VGF Nerve Growth Factor Inducible (VGF)
NCBI Accession:
NM_001039385
Species:
Mouse (Murine)
Synonyms:
VGF, Vgf
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-HA
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
HA tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948171

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3572513
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
VGF Nerve Growth Factor Inducible (VGF)
NCBI Accession:
NM_001039385
Species:
Mouse (Murine)
Synonyms:
VGF, Vgf
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-His
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
His tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948173

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3572514
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
VGF Nerve Growth Factor Inducible (VGF)
NCBI Accession:
NM_001039385
Species:
Mouse (Murine)
Synonyms:
VGF, Vgf
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-SP-N-Myc
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
MYC tag
Expression:
Transient,Stable

Empty vector controls:
ABIN4948172

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3572515
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
VGF Nerve Growth Factor Inducible (VGF)
NCBI Accession:
NM_001039385
Species:
Mouse (Murine)
Synonyms:
VGF, Vgf
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-untagged
Resistance Gene:
Ampicillin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Expression:
Transient,Stable

Empty vector controls:
ABIN4948161

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3572516
$302.94
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
VGF Nerve Growth Factor Inducible (VGF)
NCBI Accession:
NM_001039385
Species:
Mouse (Murine)
Synonyms:
VGF, Vgf
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-GFPSpark
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
GFPSpark
Expression:
Transient,Stable

Empty vector controls:
ABIN4948176

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3572507
$338.24
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days

Type:
ORF
Application:
Protein Expression
Gene:
VGF Nerve Growth Factor Inducible (VGF)
NCBI Accession:
NM_001039385
Species:
Mouse (Murine)
Synonyms:
VGF, Vgf
Vector type:
Mammalian Expression Vector
Vector backbone:
pCMV3-C-OFPSpark
Resistance Gene:
Kanamycin
Selection Marker:
Hygromycin
Promoter:
Enhanced CMV Promoter
Fusion Tag:
OFPSpark
Expression:
Transient,Stable

Empty vector controls:
ABIN4948175

Sequencing Primer:
  • T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Format:
Lyophilized
Storage:
RT
Catalog No. ABIN3572511
$338.24
1 vial
Plus shipping costs $45.00
Delivery in 20 to 26 Business Days
  • <
  • 1

Synonyms and alternative names related to VGF

  • VGF nerve growth factor inducible (VGF)
  • VGF nerve growth factor inducible (Vgf)
  • Gm1052
  • VGF

Gene-IDs for different species

GENE IDSPECIES
463616 Pan troglodytes
100595566 Nomascus leucogenys
618042 Bos taurus
7425 Homo sapiens
381677 Mus musculus
29461 Rattus norvegicus
100687924 Canis lupus familiaris

Protein level used designations for VGF

  • VGF nerve growth factor inducible
  • Neurosecretory protein VGF
  • neuro-endocrine specific protein VGF
  • neurosecretory protein VGF
  • VGF8a protein
Other products related to VGF such as antibodies, ELISA kits and high-purity proteins are available on our partner website antibodies-online.com